Information

Pink E.coli cell pellet. Reasons?

Pink E.coli cell pellet. Reasons?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I've harvested IPTG induced E.coli BL21DE3 cells' suspension culture by spinning at 5000 rpm/15 min/4 degrees C. The pellet after spin looked pale pink colored. What could be the reasons?


2.3B: The Gram-Negative Cell Wall

  • Contributed by Gary Kaiser
  • Professor (Microbiology) at Community College of Baltimore Country (Cantonsville)
  1. State what color Gram-negative bacteria stain after the Gram stain procedure.
  2. Describe the composition of a Gram-negative cell wall and indicate the possible beneficial functions to the bacterium of peptidoglycan, the outer membrane, lipopolysaccharides, porins, and surface proteins.
  3. Briefly describe how LPS and other PAMPs of the Gram-negative cell wall can promote inflammation.
  4. State the function of bacterial adhesins, secretion systems, and invasins.
  5. Define periplasm.
  6. Define antigen and epitope.

Highlighted Bacterium

  1. Read the description of Escherichia coli, and match the bacterium with the description of the organism and the infection it causes.

Highlighted Disease: Urinary Tract Infections (UTIs)

We will now look at the Gram-negative bacterial cell wall. As mentioned in the previous section on peptidoglycan, Gram-negative bacteria are those that decolorize during the Gram stain procedure, pick up the counterstain safranin, and appear pink (Figure (PageIndex<2>)B.1).

Figure (PageIndex<2>)B.1: Gram Stain of Escherichia coli. Note Gram-negative (pink) bacilli.

Common Gram-negative bacteria of medical importance include Salmonella species, Shigella species, Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Proteus species, and Pseudomonas aeruginosa.

Clinical Disease

  • E. coli causes around 80 percent of all uncomplicated urinary tract infections (UTIs) and more than 50 percent of nosocomial UTIs. UTIs account for more than 7, 000,000 physician office visits per year in the U.S. Between 35 and 40 percent of all nosocomial infections, about 900,000 per year in the U.S., are UTIs and are usually associated with urinary catheterization.
  • E. coli causes wound infections, usually a result of fecal contamination of external wounds or a result of wounds that cause trauma to the intestinal tract, such as surgical wounds, gunshot wounds, knife wounds, etc.
  • E. coli is by far the most common Gram-negative bacterium causing sepsis. Septicemia is a result of bacteria getting into the blood. They are usually introduced into the blood from some other infection site, such as an infected kidney, wound, or lung. There are approximately 500,000 cases of septicemia per year in the U.S. and the mortality rate is between 20 and 50 percent. Approximately 45 percent of the cases of septicemia are due to Gram-negative bacteria. Klebsiella, Proteus, Enterobacter, Serratia, and E. coli, are all common gram-negative bacteria causing septicemia.
  • E. coli, along with group B streptococci, are the leading cause of neonatal meningitis.
  • While E. coli is one of the dominant normal flora in the intestinal tract of humans and animals, some strains can cause gastroenteritis, an infection of the intestinal tract.
    • Enterotoxigenc E. coli (ETEC) produce enterotoxins that cause the loss of sodium ions and water from the small intestines resulting in a watery diarrhea. Over half of all travelers' diarrhea is due to ETEC almost 80,000 cases a year in the U.S.
    • Enteropathogenic E. coli (EPEC) cause an endemic diarrhea in areas of the developing world, especially in infants younger than 6 months. The bacterium disrupts the normal microvilli on the epithelial cells of the small intestines resulting in maladsorbtion and diarrhea.
    • Enteroaggregative E. coli (EAEC) is a cause of persistant diarrhea in developing countries. It probably causes diarrhea by adhering to mucosal epithelial cells of the small intestines and interfering with their function.
    • Enteroinvasive E. coli (EIEC) invade and kill epithelial cells of the large intestines causing a dysentery-type syndrome similar to Shigella common in underdeveloped countries.
    • Enterohemorrhagic E. coli (EHEC), such as E. coli 0157:H7, produce a shiga-like toxin that kills epithelial cells of the large intestines causing hemorrhagic colitis, a bloody diarrhea. In rare cases, the shiga-toxin enters the blood and is carried to the kidneys where, usually in children, it damages vascular cells and causes hemolytic uremic syndrome. E. coli 0157:H7 is thought to cause more than 20,000 infections and up to 250 deaths per year in the U.S.
    • Diffuse aggreegative E. coli(DAEC) causes watery diarrhea in infants 1-5 years of age. They stimulate elongation of the microvilli on the epithelial cells lining the small intestines.
    • For More Information: The Gram Stain from Lab 6.
    • Flash animation illustrating the interaction of the Gram's stain reagents at a molecular level © Daniel Cavanaugh, Mark Keen, authors, Licensed for use, ASM MicrobeLibrary.
    • Highlighted Infection: Urinary Tract Infections (UTIs)

    Answers

    Yes, resuspension involves breaking up the cell pellet. It means to get the cells back into solution. Usually this involves vortexing the sample, which isn’t exactly gentle but at that stage of the procedure is usually not a problem. It’s only after lysis stocks are added that more care needs to be taken so that genomic DNA is not shredded.

    BhacSsylan ( 9522 />) “Great Answer” ( 3 />) ScottyMcGeester ( 1897 />) “Great Answer” ( 0 />)

    Say you have a DNA pellet. Not a cell pellet this time. Obviously it’s very small, but you assume it’s there in the tube after you wash it with ethanol. My procedure says “remove excess ethanol”. I’m unsure about how this is worded because it’s not exactly clear if that means “remove all the ethanol you used to wash the DNA” or “remove only some of it”.

    I have gotten results before but the point is – what’s the best way to remove ethanol after washing a DNA pellet and then resuspending it? How am I sure that I didn’t accidentally pipette some DNA out when I removed the ethanol?

    ScottyMcGeester ( 1897 />) “Great Answer” ( 0 />)

    Hmm, I haven’t ever washed DNA with ethanol before, that’s strange. Well, columns I have, but not a pellet. In general, though, you need to get rid of all of it. Ethanol will disrupt most reactions you’d want to do with DNA. For getting rid of it, blowing air is probably the best method, since it will evaporate readily, but you’ll have to be careful to make sure it really it fully gone.

    BhacSsylan ( 9522 />) “Great Answer” ( 0 />)

    Contents

    Type and morphology Edit

    E. coli is a Gram-negative, facultative anaerobe (that makes ATP by aerobic respiration if oxygen is present, but is capable of switching to fermentation or anaerobic respiration if oxygen is absent) and nonsporulating bacterium. [17] Cells are typically rod-shaped, and are about 2.0 μm long and 0.25–1.0 μm in diameter, with a cell volume of 0.6–0.7 μm 3 . [18] [19] [20]

    E. coli stains Gram-negative because its cell wall is composed of a thin peptidoglycan layer and an outer membrane. During the staining process, E. coli picks up the color of the counterstain safranin and stains pink. The outer membrane surrounding the cell wall provides a barrier to certain antibiotics such that E. coli is not damaged by penicillin. [15]

    Strains that possess flagella are motile. The flagella have a peritrichous arrangement. [21] It also attaches and effaces to the microvilli of the intestines via an adhesion molecule known as intimin. [22]

    Metabolism Edit

    E. coli can live on a wide variety of substrates and uses mixed acid fermentation in anaerobic conditions, producing lactate, succinate, ethanol, acetate, and carbon dioxide. Since many pathways in mixed-acid fermentation produce hydrogen gas, these pathways require the levels of hydrogen to be low, as is the case when E. coli lives together with hydrogen-consuming organisms, such as methanogens or sulphate-reducing bacteria. [23]

    In addition, E. coli's metabolism can be rewired to solely use CO2 as the source of carbon for biomass production. In other words, this obligate heterotroph's metabolism can be altered to display autotrophic capabilities by heterologously expressing carbon fixation genes as well as formate dehydrogenase and conducting laboratory evolution experiments. This may be done by using formate to reduce electron carriers and supply the ATP required in anabolic pathways inside of these synthetic autotrophs. [24]

    E. coli have three native glycolytic pathways: EMPP, EDP, and OPPP. The EMPP employs ten enzymatic steps to yield two pyruvates, two ATP, and two NADH per glucose molecule while OPPP serves as an oxidation route for NADPH synthesis. Although the EDP is the more thermodynamically favorable of the three pathways, E. coli do not use the EDP for glucose metabolism, relying mainly on the EMPP and the OPPP. The EDP mainly remains inactive except for during growth with gluconate. [25]

    Catabolite Repression Edit

    When growing in the presence of a mixture of sugars, bacteria will often consume the sugars sequentially through a process known as catabolite repression. By repressing the expression of the genes involved in metabolizing the less preferred sugars, cells will usually first consume the sugar yielding the highest growth rate, followed by the sugar yielding the next highest growth rate, and so on. In doing so the cells ensure that their limited metabolic resources are being used to maximize the rate of growth. The well-used example of this with E. coli involves the growth of the bacterium on glucose and lactose, where E. coli will consume glucose before lactose. Catabolite repression has also been observed in E.coli in the presence of other non-glucose sugars, such as arabinose and xylose, sorbitol, rhamnose, and ribose. In E. coli, glucose catabolite repression is regulated by the phosphotransferase system, a multi-protein phosphorylation cascade that couples glucose uptake and metabolism. [26]

    Culture growth Edit

    Optimum growth of E. coli occurs at 37 °C (98.6 °F), but some laboratory strains can multiply at temperatures up to 49 °C (120 °F). [27] E. coli grows in a variety of defined laboratory media, such as lysogeny broth, or any medium that contains glucose, ammonium phosphate monobasic, sodium chloride, magnesium sulfate, potassium phosphate dibasic, and water. Growth can be driven by aerobic or anaerobic respiration, using a large variety of redox pairs, including the oxidation of pyruvic acid, formic acid, hydrogen, and amino acids, and the reduction of substrates such as oxygen, nitrate, fumarate, dimethyl sulfoxide, and trimethylamine N-oxide. [28] E. coli is classified as a facultative anaerobe. It uses oxygen when it is present and available. It can, however, continue to grow in the absence of oxygen using fermentation or anaerobic respiration. The ability to continue growing in the absence of oxygen is an advantage to bacteria because their survival is increased in environments where water predominates. [15]

    Cell cycle Edit

    The bacterial cell cycle is divided into three stages. The B period occurs between the completion of cell division and the beginning of DNA replication. The C period encompasses the time it takes to replicate the chromosomal DNA. The D period refers to the stage between the conclusion of DNA replication and the end of cell division. [29] The doubling rate of E. coli is higher when more nutrients are available. However, the length of the C and D periods do not change, even when the doubling time becomes less than the sum of the C and D periods. At the fastest growth rates, replication begins before the previous round of replication has completed, resulting in multiple replication forks along the DNA and overlapping cell cycles. [30]

    The number of replication forks in fast growing E. coli typically follows 2n (n = 1, 2 or 3). This only happens if replication is initiated simultaneously from all origins of replications, and is referred to as synchronous replication. However, not all cells in a culture replicate synchronously. In this case cells do not have multiples of two replication forks. Replication initiation is then referred to being asynchronous. [31] However, asynchrony can be caused by mutations to for instance DnaA [31] or DnaA initiator-associating protein DiaA. [32]

    Genetic adaptation Edit

    E. coli and related bacteria possess the ability to transfer DNA via bacterial conjugation or transduction, which allows genetic material to spread horizontally through an existing population. The process of transduction, which uses the bacterial virus called a bacteriophage, [33] is where the spread of the gene encoding for the Shiga toxin from the Shigella bacteria to E. coli helped produce E. coli O157:H7, the Shiga toxin-producing strain of E. coli.

    E. coli encompasses an enormous population of bacteria that exhibit a very high degree of both genetic and phenotypic diversity. Genome sequencing of many isolates of E. coli and related bacteria shows that a taxonomic reclassification would be desirable. However, this has not been done, largely due to its medical importance, [34] and E. coli remains one of the most diverse bacterial species: only 20% of the genes in a typical E. coli genome is shared among all strains. [35]

    In fact, from the more constructive point of view, the members of genus Shigella (S. dysenteriae, S. flexneri, S. boydii, and S. sonnei) should be classified as E. coli strains, a phenomenon termed taxa in disguise. [36] Similarly, other strains of E. coli (e.g. the K-12 strain commonly used in recombinant DNA work) are sufficiently different that they would merit reclassification.

    A strain is a subgroup within the species that has unique characteristics that distinguish it from other strains. These differences are often detectable only at the molecular level however, they may result in changes to the physiology or lifecycle of the bacterium. For example, a strain may gain pathogenic capacity, the ability to use a unique carbon source, the ability to take upon a particular ecological niche, or the ability to resist antimicrobial agents. Different strains of E. coli are often host-specific, making it possible to determine the source of fecal contamination in environmental samples. [12] [13] For example, knowing which E. coli strains are present in a water sample allows researchers to make assumptions about whether the contamination originated from a human, another mammal, or a bird.

    Serotypes Edit

    A common subdivision system of E. coli, but not based on evolutionary relatedness, is by serotype, which is based on major surface antigens (O antigen: part of lipopolysaccharide layer H: flagellin K antigen: capsule), e.g. O157:H7). [37] It is, however, common to cite only the serogroup, i.e. the O-antigen. At present, about 190 serogroups are known. [38] The common laboratory strain has a mutation that prevents the formation of an O-antigen and is thus not typeable.

    Genome plasticity and evolution Edit

    Like all lifeforms, new strains of E. coli evolve through the natural biological processes of mutation, gene duplication, and horizontal gene transfer in particular, 18% of the genome of the laboratory strain MG1655 was horizontally acquired since the divergence from Salmonella. [39] E. coli K-12 and E. coli B strains are the most frequently used varieties for laboratory purposes. Some strains develop traits that can be harmful to a host animal. These virulent strains typically cause a bout of diarrhea that is often self-limiting in healthy adults but is frequently lethal to children in the developing world. [40] More virulent strains, such as O157:H7, cause serious illness or death in the elderly, the very young, or the immunocompromised. [40] [41]

    The genera Escherichia and Salmonella diverged around 102 million years ago (credibility interval: 57–176 mya), which coincides with the divergence of their hosts: the former being found in mammals and the latter in birds and reptiles. [42] This was followed by a split of an Escherichia ancestor into five species (E. albertii, E. coli, E. fergusonii, E. hermannii, and E. vulneris). The last E. coli ancestor split between 20 and 30 million years ago. [43]

    The long-term evolution experiments using E. coli, begun by Richard Lenski in 1988, have allowed direct observation of genome evolution over more than 65,000 generations in the laboratory. [44] For instance, E. coli typically do not have the ability to grow aerobically with citrate as a carbon source, which is used as a diagnostic criterion with which to differentiate E. coli from other, closely, related bacteria such as Salmonella. In this experiment, one population of E. coli unexpectedly evolved the ability to aerobically metabolize citrate, a major evolutionary shift with some hallmarks of microbial speciation.

    In the microbial world, a relationship of predation can be established similar to that observed in the animal world. Considered, it has been seen that E. coli is the prey of multiple generalist predators, such as Myxococcus xanthus. In this predator-prey relationship, a parallel evolution of both species is observed through genomic and phenotypic modifications, in the case of E. coli the modifications are modified in two aspects involved in their virulence such as mucoid production (excessive production of exoplasmic acid alginate ) and the suppression of the OmpT gene, producing in future generations a better adaptation of one of the species that is counteracted by the evolution of the other, following a co-evolutionary model demonstrated by the Red Queen hypothesis. [45]

    Neotype strain Edit

    E. coli is the type species of the genus (Escherichia) and in turn Escherichia is the type genus of the family Enterobacteriaceae, where the family name does not stem from the genus Enterobacter + "i" (sic.) + "aceae", but from "enterobacterium" + "aceae" (enterobacterium being not a genus, but an alternative trivial name to enteric bacterium). [46] [47]

    The original strain described by Escherich is believed to be lost, consequently a new type strain (neotype) was chosen as a representative: the neotype strain is U5/41 T , [48] also known under the deposit names DSM 30083, [49] ATCC 11775, [50] and NCTC 9001, [51] which is pathogenic to chickens and has an O1:K1:H7 serotype. [52] However, in most studies, either O157:H7, K-12 MG1655, or K-12 W3110 were used as a representative E. coli. The genome of the type strain has only lately been sequenced. [48]

    Phylogeny of E. coli strains Edit

    Many strains belonging to this species have been isolated and characterised. In addition to serotype (vide supra), they can be classified according to their phylogeny, i.e. the inferred evolutionary history, as shown below where the species is divided into six groups. [53] [54] Particularly the use of whole genome sequences yields highly supported phylogenies. Based on such data, five subspecies of E. coli were distinguished. [48]

    The link between phylogenetic distance ("relatedness") and pathology is small, [48] e.g. the O157:H7 serotype strains, which form a clade ("an exclusive group")—group E below—are all enterohaemorragic strains (EHEC), but not all EHEC strains are closely related. In fact, four different species of Shigella are nested among E. coli strains (vide supra), while E. albertii and E. fergusonii are outside this group. Indeed, all Shigella species were placed within a single subspecies of E. coli in a phylogenomic study that included the type strain, [48] and for this reason an according reclassification is difficult. All commonly used research strains of E. coli belong to group A and are derived mainly from Clifton's K-12 strain (λ + F + O16) and to a lesser degree from d'Herelle's Bacillus coli strain (B strain)(O7).

    E. coli S88 (O45:K1. Extracellular pathogenic)

    E. coli UMN026 (O17:K52:H18. Extracellular pathogenic)

    E. coli (O19:H34. Extracellular pathogenic)

    E. coli (O7:K1. Extracellular pathogenic)

    E. coli GOS1 (O104:H4 EAHEC) German 2011 outbreak

    E. coli ATCC8739 (O146. Crook's E.coli used in phage work in the 1950s)

    E. coli K-12 W3110 (O16. λ − F − "wild type" molecular biology strain)

    E. coli K-12 DH10b (O16. high electrocompetency molecular biology strain)

    E. coli K-12 DH1 (O16. high chemical competency molecular biology strain)

    E. coli K-12 MG1655 (O16. λ − F − "wild type" molecular biology strain)

    E. coli BW2952 (O16. competent molecular biology strain)

    E. coli B REL606 (O7. high competency molecular biology strain)

    E. coli BL21-DE3 (O7. expression molecular biology strain with T7 polymerase for pET system)

    The first complete DNA sequence of an E. coli genome (laboratory strain K-12 derivative MG1655) was published in 1997. It is a circular DNA molecule 4.6 million base pairs in length, containing 4288 annotated protein-coding genes (organized into 2584 operons), seven ribosomal RNA (rRNA) operons, and 86 transfer RNA (tRNA) genes. Despite having been the subject of intensive genetic analysis for about 40 years, many of these genes were previously unknown. The coding density was found to be very high, with a mean distance between genes of only 118 base pairs. The genome was observed to contain a significant number of transposable genetic elements, repeat elements, cryptic prophages, and bacteriophage remnants. [55]

    More than three hundred complete genomic sequences of Escherichia and Shigella species are known. The genome sequence of the type strain of E. coli was added to this collection before 2014. [48] Comparison of these sequences shows a remarkable amount of diversity only about 20% of each genome represents sequences present in every one of the isolates, while around 80% of each genome can vary among isolates. [35] Each individual genome contains between 4,000 and 5,500 genes, but the total number of different genes among all of the sequenced E. coli strains (the pangenome) exceeds 16,000. This very large variety of component genes has been interpreted to mean that two-thirds of the E. coli pangenome originated in other species and arrived through the process of horizontal gene transfer. [56]

    Genes in E. coli are usually named by 4-letter acronyms that derive from their function (when known) and italicized. For instance, recA is named after its role in homologous recombination plus the letter A. Functionally related genes are named recB, recC, recD etc. The proteins are named by uppercase acronyms, e.g. RecA, RecB, etc. When the genome of E. coli was sequenced, all genes were numbered (more or less) in their order on the genome and abbreviated by b numbers, such as b2819 (= recD). The "b" names were created after Fred Blattner, who led the genome sequence effort. [55] Another numbering system was introduced with the sequence of another E. coli strain, W3110, which was sequenced in Japan and hence uses numbers starting by JW. (Japanese W3110), e.g. JW2787 (= recD). [57] Hence, recD = b2819 = JW2787. Note, however, that most databases have their own numbering system, e.g. the EcoGene database [58] uses EG10826 for recD. Finally, ECK numbers are specifically used for alleles in the MG1655 strain of E. coli K-12. [58] Complete lists of genes and their synonyms can be obtained from databases such as EcoGene or Uniprot.

    Proteome Edit

    Several studies have investigated the proteome of E. coli. By 2006, 1,627 (38%) of the 4,237 open reading frames (ORFs) had been identified experimentally. [59] The 4,639,221–base pair sequence of Escherichia coli K-12 is presented. Of 4288 protein-coding genes annotated, 38 percent have no attributed function. Comparison with five other sequenced microbes reveals ubiquitous as well as narrowly distributed gene families many families of similar genes within E. coli are also evident. The largest family of paralogous proteins contains 80 ABC transporters. The genome as a whole is strikingly organized with respect to the local direction of replication guanines, oligonucleotides possibly related to replication and recombination, and most genes are so oriented. The genome also contains insertion sequence (IS) elements, phage remnants, and many other patches of unusual composition indicating genome plasticity through horizontal transfer. [55]

    Interactome Edit

    The interactome of E. coli has been studied by affinity purification and mass spectrometry (AP/MS) and by analyzing the binary interactions among its proteins.

    Protein complexes. A 2006 study purified 4,339 proteins from cultures of strain K-12 and found interacting partners for 2,667 proteins, many of which had unknown functions at the time. [60] A 2009 study found 5,993 interactions between proteins of the same E. coli strain, though these data showed little overlap with those of the 2006 publication. [61]

    Binary interactions. Rajagopala et al. (2014) have carried out systematic yeast two-hybrid screens with most E. coli proteins, and found a total of 2,234 protein-protein interactions. [62] This study also integrated genetic interactions and protein structures and mapped 458 interactions within 227 protein complexes.

    E. coli belongs to a group of bacteria informally known as coliforms that are found in the gastrointestinal tract of warm-blooded animals. [63] E. coli normally colonizes an infant's gastrointestinal tract within 40 hours of birth, arriving with food or water or from the individuals handling the child. In the bowel, E. coli adheres to the mucus of the large intestine. It is the primary facultative anaerobe of the human gastrointestinal tract. [64] (Facultative anaerobes are organisms that can grow in either the presence or absence of oxygen.) As long as these bacteria do not acquire genetic elements encoding for virulence factors, they remain benign commensals. [65]

    Therapeutic use Edit

    Due to the low cost and speed with which it can be grown and modified in laboratory settings, E. coli is a popular expression platform for the production of recombinant proteins used in therapeutics. One advantage to using E. coli over another expression platform is that E. coli naturally does not export many proteins into the periplasm, making it easier to recover a protein of interest without cross-contamination. [66] The E. coli K-12 strains and their derivatives (DH1, DH5α, MG1655, RV308 and W3110) are the strains most widely used by the biotechnology industry. [67] Nonpathogenic E. coli strain Nissle 1917 (EcN), (Mutaflor) and E. coli O83:K24:H31 (Colinfant) [68] [69] ) are used as probiotic agents in medicine, mainly for the treatment of various gastrointestinal diseases, [70] including inflammatory bowel disease. [71] It is thought that the EcN strain might impede the growth of opportunistic pathogens, including Salmonella and other coliform enteropathogens, through the production of microcin proteins the production of siderophores. [72]

    Most E. coli strains do not cause disease, naturally living in the gut, [73] but virulent strains can cause gastroenteritis, urinary tract infections, neonatal meningitis, hemorrhagic colitis, and Crohn's disease. Common signs and symptoms include severe abdominal cramps, diarrhea, hemorrhagic colitis, vomiting, and sometimes fever. In rarer cases, virulent strains are also responsible for bowel necrosis (tissue death) and perforation without progressing to hemolytic-uremic syndrome, peritonitis, mastitis, sepsis, and Gram-negative pneumonia. Very young children are more susceptible to develop severe illness, such as hemolytic uremic syndrome however, healthy individuals of all ages are at risk to the severe consequences that may arise as a result of being infected with E. coli. [64] [74] [75] [76]

    Some strains of E. coli, for example O157:H7, can produce Shiga toxin (classified as a bioterrorism agent). The Shiga toxin causes inflammatory responses in target cells of the gut, leaving behind lesions which result in the bloody diarrhea that is a symptom of a Shiga toxin-producing E. coli (STEC) infection. This toxin further causes premature destruction of the red blood cells, which then clog the body's filtering system, the kidneys, in some rare cases (usually in children and the elderly) causing hemolytic-uremic syndrome (HUS), which may lead to kidney failure and even death. Signs of hemolytic uremic syndrome include decreased frequency of urination, lethargy, and paleness of cheeks and inside the lower eyelids. In 25% of HUS patients, complications of nervous system occur, which in turn causes strokes. In addition, this strain causes the buildup of fluid (since the kidneys do not work), leading to edema around the lungs, legs, and arms. This increase in fluid buildup especially around the lungs impedes the functioning of the heart, causing an increase in blood pressure. [77] [22] [78] [79] [80] [75] [76]

    Uropathogenic E. coli (UPEC) is one of the main causes of urinary tract infections. [81] It is part of the normal microbiota in the gut and can be introduced in many ways. In particular for females, the direction of wiping after defecation (wiping back to front) can lead to fecal contamination of the urogenital orifices. Anal intercourse can also introduce this bacterium into the male urethra, and in switching from anal to vaginal intercourse, the male can also introduce UPEC to the female urogenital system.

    Enterotoxigenic E. coli (ETEC) is the most common cause of traveler's diarrhea, with as many as 840 million cases worldwide in developing countries each year. The bacteria, typically transmitted through contaminated food or drinking water, adheres to the intestinal lining, where it secretes either of two types of enterotoxins, leading to watery diarrhea. The rate and severity of infections are higher among children under the age of five, including as many as 380,000 deaths annually. [82]

    In May 2011, one E. coli strain, O104:H4, was the subject of a bacterial outbreak that began in Germany. Certain strains of E. coli are a major cause of foodborne illness. The outbreak started when several people in Germany were infected with enterohemorrhagic E. coli (EHEC) bacteria, leading to hemolytic-uremic syndrome (HUS), a medical emergency that requires urgent treatment. The outbreak did not only concern Germany, but also 15 other countries, including regions in North America. [83] On 30 June 2011, the German Bundesinstitut für Risikobewertung (BfR) (Federal Institute for Risk Assessment, a federal institute within the German Federal Ministry of Food, Agriculture and Consumer Protection) announced that seeds of fenugreek from Egypt were likely the cause of the EHEC outbreak. [84]

    Some studies have demonstrated an absence of E.coli in the gut flora of subjects with the metabolic disorder Phenylketonuria. It is hypothesized that the absence of these normal bacterium impairs the production of the key vitamins B2 (riboflavin) and K2 (menaquinone) - vitamins which are implicated in many physiological roles in humans such as cellular and bone metabolism - and so contributes to the disorder. [85]

    Incubation period Edit

    The time between ingesting the STEC bacteria and feeling sick is called the "incubation period". The incubation period is usually 3–4 days after the exposure, but may be as short as 1 day or as long as 10 days. The symptoms often begin slowly with mild belly pain or non-bloody diarrhea that worsens over several days. HUS, if it occurs, develops an average 7 days after the first symptoms, when the diarrhea is improving. [86]

    Diagnosis Edit

    Diagnosis of infectious diarrhea and identification of antimicrobial resistance is performed using a stool culture with subsequent antibiotic sensitivity testing. It requires a minimum of 2 days and maximum of several weeks to culture gastrointestinal pathogens. The sensitivity (true positive) and specificity (true negative) rates for stool culture vary by pathogen, although a number of human pathogens can not be cultured. For culture-positive samples, antimicrobial resistance testing takes an additional 12-24 hours to perform.

    Current point of care molecular diagnostic tests can identify E. coli and antimicrobial resistance in the identified strains much faster than culture and sensitivity testing. Microarray-based platforms can identify specific pathogenic strains of E. coli and E. coli-specific AMR genes in two hours or less with high sensitivity and specificity, but the size of the test panel (i.e., total pathogens and antimicrobial resistance genes) is limited. Newer metagenomics-based infectious disease diagnostic platforms are currently being developed to overcome the various limitations of culture and all currently available molecular diagnostic technologies.

    Treatment Edit

    The mainstay of treatment is the assessment of dehydration and replacement of fluid and electrolytes. Administration of antibiotics has been shown to shorten the course of illness and duration of excretion of enterotoxigenic E. coli (ETEC) in adults in endemic areas and in traveller's diarrhea, though the rate of resistance to commonly used antibiotics is increasing and they are generally not recommended. [87] The antibiotic used depends upon susceptibility patterns in the particular geographical region. Currently, the antibiotics of choice are fluoroquinolones or azithromycin, with an emerging role for rifaximin. Oral rifaximin, a semisynthetic rifamycin derivative, is an effective and well-tolerated antibacterial for the management of adults with non-invasive traveller's diarrhea. Rifaximin was significantly more effective than placebo and no less effective than ciprofloxacin in reducing the duration of diarrhea. While rifaximin is effective in patients with E. coli-predominant traveller's diarrhea, it appears ineffective in patients infected with inflammatory or invasive enteropathogens. [88]

    Prevention Edit

    ETEC is the type of E. coli that most vaccine development efforts are focused on. Antibodies against the LT and major CFs of ETEC provide protection against LT-producing, ETEC-expressing homologous CFs. Oral inactivated vaccines consisting of toxin antigen and whole cells, i.e. the licensed recombinant cholera B subunit (rCTB)-WC cholera vaccine Dukoral, have been developed. There are currently no licensed vaccines for ETEC, though several are in various stages of development. [89] In different trials, the rCTB-WC cholera vaccine provided high (85–100%) short-term protection. An oral ETEC vaccine candidate consisting of rCTB and formalin inactivated E. coli bacteria expressing major CFs has been shown in clinical trials to be safe, immunogenic, and effective against severe diarrhoea in American travelers but not against ETEC diarrhoea in young children in Egypt. A modified ETEC vaccine consisting of recombinant E. coli strains over-expressing the major CFs and a more LT-like hybrid toxoid called LCTBA, are undergoing clinical testing. [90] [91]

    Other proven prevention methods for E. coli transmission include handwashing and improved sanitation and drinking water, as transmission occurs through fecal contamination of food and water supplies. Additionally, thoroughly cooking meat and avoiding consumption of raw, unpasteurized beverages, such as juices and milk are other proven methods for preventing E.coli. Lastly, avoid cross-contamination of utensils and work spaces when preparing food. [92]

    Because of its long history of laboratory culture and ease of manipulation, E. coli plays an important role in modern biological engineering and industrial microbiology. [93] The work of Stanley Norman Cohen and Herbert Boyer in E. coli, using plasmids and restriction enzymes to create recombinant DNA, became a foundation of biotechnology. [94]

    E. coli is a very versatile host for the production of heterologous proteins, [95] and various protein expression systems have been developed which allow the production of recombinant proteins in E. coli. Researchers can introduce genes into the microbes using plasmids which permit high level expression of protein, and such protein may be mass-produced in industrial fermentation processes. One of the first useful applications of recombinant DNA technology was the manipulation of E. coli to produce human insulin. [96]

    Many proteins previously thought difficult or impossible to be expressed in E. coli in folded form have been successfully expressed in E. coli. For example, proteins with multiple disulphide bonds may be produced in the periplasmic space or in the cytoplasm of mutants rendered sufficiently oxidizing to allow disulphide-bonds to form, [97] while proteins requiring post-translational modification such as glycosylation for stability or function have been expressed using the N-linked glycosylation system of Campylobacter jejuni engineered into E. coli. [98] [99] [100]

    Modified E. coli cells have been used in vaccine development, bioremediation, production of biofuels, [101] lighting, and production of immobilised enzymes. [95] [102]

    Strain K-12 is a mutant form of E. coli that over-expresses the enzyme Alkaline Phosphatase (ALP). [103] The mutation arises due to a defect in the gene that constantly codes for the enzyme. A gene that is producing a product without any inhibition is said to have constitutive activity. This particular mutant form is used to isolate and purify the aforementioned enzyme. [103]

    Strain OP50 of Escherichia coli is used for maintenance of Caenorhabditis elegans cultures.

    Strain JM109 is a mutant form of E. coli that is recA and endA deficient. The strain can be utilized for blue/white screening when the cells carry the fertility factor episome [104] Lack of recA decreases the possibility of unwanted restriction of the DNA of interest and lack of endA inhibit plasmid DNA decomposition. Thus, JM109 is useful for cloning and expression systems.

    Model organism Edit

    E. coli is frequently used as a model organism in microbiology studies. Cultivated strains (e.g. E. coli K12) are well-adapted to the laboratory environment, and, unlike wild-type strains, have lost their ability to thrive in the intestine. Many laboratory strains lose their ability to form biofilms. [105] [106] These features protect wild-type strains from antibodies and other chemical attacks, but require a large expenditure of energy and material resources. E. coli is often used as a representative microorganism in the research of novel water treatment and sterilisation methods, including photocatalysis. By standard plate count methods, following sequential dilutions, and growth on agar gel plates, the concentration of viable organisms or CFUs (Colony Forming Units), in a known volume of treated water can be evaluated, allowing the comparative assessment of materials performance. [107]

    In 1946, Joshua Lederberg and Edward Tatum first described the phenomenon known as bacterial conjugation using E. coli as a model bacterium, [108] and it remains the primary model to study conjugation. [109] E. coli was an integral part of the first experiments to understand phage genetics, [110] and early researchers, such as Seymour Benzer, used E. coli and phage T4 to understand the topography of gene structure. [111] Prior to Benzer's research, it was not known whether the gene was a linear structure, or if it had a branching pattern. [112]

    E. coli was one of the first organisms to have its genome sequenced the complete genome of E. coli K12 was published by Science in 1997 [55]

    From 2002 to 2010, a team at the Hungarian Academy of Science created a strain of Escherichia coli called MDS42, which is now sold by Scarab Genomics of Madison, WI under the name of "Clean Genome. E.coli", [113] where 15% of the genome of the parental strain (E. coli K-12 MG1655) were removed to aid in molecular biology efficiency, removing IS elements, pseudogenes and phages, resulting in better maintenance of plasmid-encoded toxic genes, which are often inactivated by transposons. [114] [115] [116] Biochemistry and replication machinery were not altered.

    By evaluating the possible combination of nanotechnologies with landscape ecology, complex habitat landscapes can be generated with details at the nanoscale. [117] On such synthetic ecosystems, evolutionary experiments with E. coli have been performed to study the spatial biophysics of adaptation in an island biogeography on-chip.

    Studies are also being performed attempting to program E. coli to solve complicated mathematics problems, such as the Hamiltonian path problem. [118]

    In other studies, non-pathogenic E. coli has been used as a model microorganism towards understanding the effects of simulated microgravity (on Earth) on the same. [119] [120]

    In 1885, the German-Austrian pediatrician Theodor Escherich discovered this organism in the feces of healthy individuals. He called it Bacterium coli commune because it is found in the colon. Early classifications of prokaryotes placed these in a handful of genera based on their shape and motility (at that time Ernst Haeckel's classification of bacteria in the kingdom Monera was in place). [91] [121] [122]

    Bacterium coli was the type species of the now invalid genus Bacterium when it was revealed that the former type species ("Bacterium triloculare") was missing. [123] Following a revision of Bacterium, it was reclassified as Bacillus coli by Migula in 1895 [124] and later reclassified in the newly created genus Escherichia, named after its original discoverer. [125]

    In 1996, the world's worst to date outbreak of E. coli food poisoning occurred in Wishaw, Scotland, killing 21 people. [126] This death toll was exceeded in 2011, when the 2011 Germany E. coli O104:H4 outbreak, linked to organic fenugreek sprouts, killed 53 people.


    Discussion

    In this study, the BANA and BARNA light-powered systems were constructed and employed to spatiotemporally regulate the cell division of E. coli. When the BANA light-powered system was used to shorten cell division of E. coli DN4, the SSA and acetoin titer of E. coli DN4 were increased to 3.7 μm −1 and 67.2 g L −1 , which were 20.39 and 39.19% higher than these of E. coli D1, respectively. When the BARNA light-powered system was used to prolong the cell division of E. coli DQ8, the MCV, PLH content, DCW, and PLH titer of E. coli DQ8 were increased to 52.6 μm 3 , 53.8 wt%, 26.6 and 14.31 g L −1 , which were 13.65-fold, 2.01-fold, 1.18-fold, and 2.38-fold higher than these of E. coli DQ0, respectively. These results demonstrated that engineering the C and D periods of cell division represented an useful strategy to streamline the efficiency of microbial cell factories.

    Cell division in Escherichia coli is mediated by a large protein complex and deoxyribonucleotides 31,37 , which are regulated by two factors: (i) a positive regulator: the nrdAB, nrdA, nrdB, and nrdD genes in the C period of cell division catalyze deoxyribonucleoside diphosphate for dNTP production to promote DNA replication for cell division, and then the ftsZA, ftsZ, ftsA, ftsN, and ftsQ genes in the D period of cell division assemble into a Z-ring scaffold to accelerate cell division (ii) a negative regulator: the deletion of the nrdAB, nrdA, nrdB, and nrdD genes in the C period of cell division can perturb dNTP synthesis, and then the sulA, minC, minD, minE, and ftsH genes in the D period of cell division are the inhibitors of cell division. To regulate cell division at multiple levels, optogenetics is a promising strategy in a noninvasive, reversible, and spatiotemporal way 33 . For example, a blue light feedback gene circuit was used to reversibly regulate pyruvate decarboxylation to decouple cell growth and chemical production, resulting in isobutanol and 2-methyl-1-butanol production up to 8.49 g L −1 and 2.38 g L −1 , respectively 33 . In addition, red light and blue light were utilized to regulate the Bphs and BlrP1 proteins for biofilm formation 44 . Based on these studies, an optogenetics-based cell division strategy was proposed: the optogenetic strategy was used to shorten or prolong the C+D period of cell division by spatiotemporally controlling the genes involved in the C+D periods of cell division in different phases with various light illumination intensities and times. Thus, two different light-powered systems, BANA and BARNA, were constructed. A BARNA light-powered system was used for weak expression of nrdA and overexpression of nrdAB, ftsZA, and sulA in E. coli DQ8, and thus the C and D periods of cell division were prolonged. As a result, this system causes the mini-cell phenotype 29 and increases the cell count and cell growth 30,45 . To hinder DNA replication and decrease cell division frequency, a BARNA light-powered system was used for weak expression of nrdA and overexpression of nrdAB, ftsZA, and sulA in E. coli DQ8, and thus the C and D periods of cell division was prolonged. Thus, this system causes a large-cell phenotype and decreases cell count and cell growth 13,46 .

    As a vital physiological parameter of industrial microbes 20,47 , SSA could increase mass transfer by enhancing the nutrient uptake rate and cell growth and improve cell density by changing the rheology of cultures. During industrial fermentation, SSA can be affected by mechanical pressure, medium contents, and chemical stress 16 . Thus, many efforts have showed their application potential in regulating SSA, such as microparticle cultivation 20 , fermentation optimization 48 , and laboratory adaptive evolution engineering 49 . Based on these strategies, the efficiency of chemical production will be enhanced by increasing the SSA of industrial microbes. In this study, when the C and D periods of cell division were shortened by BANA, the SSA was showed a 20.39% increase. As a result, the acetoin titer was increased by 39.19% compared to that of E. coli D1. These results indicated that acetoin production was improved by accurately controlling cell division and engineering SSA. This study was different from the previous studies that engineered target metabolic pathways 41 and eliminated carbon catabolite repression 50 .

    The MCV of industrial microbes is an important physiological parameter 51 , where we want to maximize inclusion body production. In addition, MCV should be also considered to improve the efficiency of upstream and downstream bioprocessing through faster precipitation of cells with relatively higher gravity. To manipulate the MCV of industrial microbes, a series of strategies have been developed such as perturbing the peptidoglycan cell wall synthesis to obtain a more elastic and flexible cell structure 24 , screening the cytoskeletal mutants for morphological properties 25 , and disturbing the phosphatidylinositol biosynthesis in vivo for the formation of filamentous structures 23 . In this study, when the C and D periods of cell division were prolonged by BARNA light-powered systems, the MCV of E. coli DQ8 was showed a 13.65-fold increase. As a result, the cell space for PLH accumulation was increased, and thus the PLH content of E. coli DQ8 was increased by 2.01-fold compared to that of E. coli DQ0. These results indicated the PLH production was improved by accurately regulating the C and D periods of cell division to increase the MCV of E. coli DQ8. Weak expression of nrdA could prolong the C period of cell division by disturbing intracellular dNTP synthesis and DNA replication, and overexpression of sulA could prolong the D period of cell division by hindering Z ring formation and divisome assembly 46 . Thus, the frequency of cell division would be affected by prolonging cell division 29 , leading to an increase in cell size. The larger cell space for PLH accumulation improved the PLH content, titer, and DCW. The strategy in this study was different from the previous strategies, such as engineering the target metabolic pathways 52 , utilizing the post translational metabolic switching 53 , and controlling the cofactor ratio 54 .

    In this study, an optogenetics-based cell division strategy was developed, which is noninvasive and incorporates spatial, temporal and reversible control. The SSA and MCV of E. coli were increased by shorting or prolonging the C and D periods of cell division using a BANA or BRANA light-powered system, respectively. Based on this, the higher SSA or MCV values led to the higher efficiency of acetoin or PLH production. Our results demonstrated that increasing the SSA and MCV by manipulating cell division could enhance the targeted chemical production. Furthermore, this optogenetic-based cell division strategy may provide an approach to construct microbial cell factories for high-value chemical production.


    E. Coli Bacteria: A Future Source Of Energy?

    For most people, the name "E. coli" is synonymous with food poisoning and product recalls, but a professor in Texas A&M University's chemical engineering department envisions the bacteria as a future source of energy, helping to power our cars, homes and more.

    By genetically modifying the bacteria, Thomas Wood, a professor in the Artie McFerrin Department of Chemical Engineering, has "tweaked" a strain of E. coli so that it produces substantial amounts of hydrogen. Specifically, Wood's strain produces 140 times more hydrogen than is created in a naturally occurring process, according to an article in "Microbial Biotechnology," detailing his research.

    Though Wood acknowledges that there is still much work to be done before his research translates into any kind of commercial application, his initial success could prove to be a significant stepping stone on the path to the hydrogen-based economy that many believe is in this country's future.

    Renewable, clean and efficient, hydrogen is the key ingredient in fuel-cell technology, which has the potential to power everything from portable electronics to automobiles and even entire power plants. Today, most of the hydrogen produced globally is created by a process known as "cracking water" through which hydrogen is separated from the oxygen. But the process is expensive and requires vast amounts of energy -- one of the chief reasons why the technology has yet to catch on.

    Wood's work with E. coli could change that.

    While the public may be used to hearing about the very specific strain that can cause food poisoning in humans, most strains are common and harmless, even helping their hosts by preventing other harmful bacteria from taking root in the human intestinal tract.

    And the use of E. coli in science is nothing new, having been used in the production of human insulin and in the development of vaccines.

    But as a potential energy source?

    That's new territory, and it's being pioneered by Wood and his colleagues.

    By selectively deleting six specific genes in E. coli's DNA, Wood has basically transformed the bacterium into a mini hydrogen-producing factory that's powered by sugar. Scientifically speaking, Wood has enhanced the bacteria's naturally occurring glucose-conversion process on a massive scale.

    "These bacteria have 5,000 genes that enable them to survive environmental changes," Wood explained. "When we knock things out, the bacteria become less competitive. We haven't given them an ability to do something. They don't gain anything here they lose. The bacteria that we're making are less competitive and less harmful because of what's been removed."

    With sugar as its main power source, this strain of E. coli can now take advantage of existing and ever-expanding scientific processes aimed at producing sugar from certain crops, such as corn, Wood said.

    "A lot of people are working on converting something that you grow into some kind of sugar," Wood explained. "We want to take that sugar and make it into hydrogen. We're going to get sugar from some crop somewhere. We're going to get some form of sugar-like molecule and use the bacteria to convert that into hydrogen."

    Biological methods such as this (E. coli produce hydrogen through a fermentative process) are likely to reduce energy costs since these processes don't require extensive heating or electricity," Wood said.

    "One of the most difficult things about chemical engineering is how you get the product," Wood explained. "In this case, it's very easy because the hydrogen is a gas, and it just bubbles out of the solution. You just catch the gas as it comes out of the glass. That's it. You have pure hydrogen."

    There also are other benefits.

    As might be expected, the cost of building an entirely new pipeline to transport hydrogen is a significant deterrent in the utilization of hydrogen-based fuel cell technology. In addition, there is also increased risk when transporting hydrogen.

    The solution, Wood believes, is converting hydrogen on site.

    "The main thing we think is you can transport things like sugar, and if you spill the sugar there is not a huge catastrophe," Wood said. "The idea is to make the hydrogen where you need it."

    Of course, all of this is down the road. Right now, Wood remains busy in the lab, working on refining a process that's already hinted at its incredible potential. The goal, he said, is to continue to get more out of less.

    "Take your house, for example," Wood said. "The size of the reactor that we'd need today if we implemented this technology would be less than the size of a 250-gallon fuel tank found in the typical east-coast home. I'm not finished with this yet, but at this point if we implemented the technology right now, you or a machine would have to shovel in about the weight of a man every day so that the reactor could provide enough hydrogen to take care of the average American home for a 24-hour period.

    "We're trying to make bacteria so it's doesn't require 80 kilograms it will be closer to 8 kilograms."

    Story Source:

    Materials provided by Texas A&M University. Note: Content may be edited for style and length.


    Materials and Methods

    Strains and media

    Unless otherwise noted, the strain used for the characterization of genetic circuits is E. coli MG1655 (numbering is based on the genome sequence, NCBI U00096.3 Blattner et al, 1997 ). Plasmid engineering was performed using E. coli DH10β (New England Biolabs, USA, C3019H) or E. coli DH5α (New England Biolabs, USA, C2988J). E. coli TransforMax™ EC100D™ pir + (Lucigen, USA, CP09500)) and E. coli JTK164A (Kittleson et al, 2011 ) were used for plasmids containing the R6K origin of replication. For conjugation, E. coli S17-1 λpir strain (TpR, SmR, recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir) was used as a donor strain to deliver plasmids with R6K origin of replication and OriT. LB media (BD Biosciences, USA, BD244610) were used for cell growth and cloning. 2xYT media (BD Biosciences, USA, DF0440-17) were used to grow cells for plasmid extraction with the QIAprep Spin Miniprep Kit (Qiagen, USA, 27104). Electrocompetent cells were prepped in SOB media (Teknova, USA, S0210). SOC recovery media (New England Biolabs, USA, B9020S) were used to recover cells after transformation. M9 media consist of M9 minimal salt (Sigma-Aldrich, USA, M6030) supplemented with 0.034% thiamine (Fisher Scientific, USA, BP892-100), 0.4% glucose (Fisher Chemical, USA, M-10046U), and 0.2% casaminoacids (BD Biosciences, USA, 223050). This media (hereafter referred to as “M9 media”) were used for all measurements and characterizations, unless noted otherwise. Antibiotics used are as follows: ampicillin (100 μg/ml, Amp) (GoldBio, USA, A-301-5), chloramphenicol (34 μg/ml, Cm) (Alfa Aesar, USA, AAB20841-14), kanamycin (50 μg/ml, Kan) (GoldBio, USA, K-120-10), spectinomycin (40 μg/mL, Sp) (MP Biomedicals LLC, USA, 158993), and tetracycline (5 μg/ml, Tet) (GoldBio, USA, T-101-25). All oligonucleotides, Gblocks, and oligos were ordered from IDT (Integrated DNA Technologies, USA Appendix Fig S14 and Appendix Tables S4–S8).

    Terminator identification from genome sequences

    Candidate terminators were identified from the E. coli MG1655 genome (NCBI RefSeq: NC_000913) using RNIE version 0.01 with default settings and the “genome.cm” terminator model (Gardner et al, 2011 ). This produced an output GFF file containing the location (start and end base pair), orientation (sense or antisense strand), and scoring statistics for each putative terminator part. To assess the strength of each putative terminator, transcription profiles were generated for both sense and antisense strands of the MG1655 genome from the raw RNA-seq reads (Gorochowski et al, 2017 ). Next, for each putative terminator the appropriate transcription profile for the sense or antisense strand (depending on the orientation of the terminator) was selected. The terminator strength was then estimated by measuring the average transcription profile height for the 25-bp region before and after the position of the terminator (to smooth localized fluctuations) and calculating the ratio of the average transcription profile height directly after the terminator to directly before. Finally, those terminators that had been used previously in other work (Chen et al, 2013 ) were filtered out and a final ranked list of terminators by termination strength produced.

    Measurement of terminator strength

    Terminators were characterized following a previously published assay (Chen et al, 2013 ). They were cloned into the pGR plasmid (Appendix Fig S14, Appendix Fig S1, Appendix Tables S1 and S5). Escherichia coli DH5α harboring pGR plasmids with a terminator (pGR-DT#) were cultured overnight in 200 μl of LB medium with ampicillin (100 μg/ml). Cells were cultured using Nunc™ 96-well plates (Thermo Scientific, USA, 249662) in an ELMI Digital Thermo Microplate Shaker Incubator (ELMI Ltd, Latvia hereafter “ELMI plate shaker”). The next day, cells were 200-fold diluted into 200 μl of fresh LB medium with ampicillin (100 μg/ml) and 12.5 mM L-arabinose (Sigma-Aldrich, USA, A3256). Cells were induced for 3 h at 37°C and 1,000 rpm in an ELMI plate shaker. After the induction, fluorescence levels were analyzed with flow cytometry and the geometric mean of GFP (FITC-A) and RFP (PE-Texas-RED-A) was calculated using FlowJo (TreeStar, Inc., USA) software. These geometric means were then used to calculate the terminator strength, TS = [(<GFP>term/<RFP>term)/(<GFP>ref/<RFP>ref)]. The <RFP>term and <GFP>term denote geometric mean calculated for cells containing the plasmid terminator after subtracting the autofluorescence. The <RFP>ref and <GFP>ref denote geometric mean calculated with the pGR plasmid without a terminator between GFP and RFP after subtracting the autofluorescence.

    Flow cytometry analysis

    Cytometry was performed using a LSRII Fortessa flow cytometer (BD Biosciences, USA). Upon harvesting, cells were diluted into 200 μl of 1× PBS ([NaCl]: 137 mM, [KCl]: 2.7 mM, [Na2HPO4]: 10 mM and [KH2PO4]: 1.8 mM) with 2 mg/ml kanamycin. An FSC voltage of 437 V, SSC voltage of 289 V, a green-laser (488 nm) voltage of 425 V, and a red-laser (561 nm) voltage of 489 V were used. For each sample, > 30,000 events were recorded. The recorded flow cytometry data were further analyzed with the software FlowJo. FITC-A and PE-Texas Red-A median values were used to represent the expression level distribution within a population.

    Construction of Tn5 transposon library

    The plYJP017 plasmid that contains a constitutively expressed mCherry probe was constructed by modifying the pBAMD1-4 plasmid (Martinez-Garcia et al, 2014 ). To prevent constant tnpA expression from backbone integration, sfGFP was added to the backbone as a counter-selection marker (Fig 1b). Escherichia coli S17-1 λpir electrocompetent cells were transformed with the plYJP017 plasmid. The strain harboring plYJP017 plasmid was then used for conjugation with E. coli DH10β carrying a tetracycline (Tet) resistance marker (tetA) in the genome (YJP_DHC404 Appendix Fig S14). Donor strains (E. coli S17-1 λpir) and recipient strains (E. coli DH10β) were separately grown overnight in 200 μl LB media with antibiotics at 37°C and 1,000 rpm using Nunc™ 96-well plates (Thermo Scientific, USA, 249662) in an ELMI plate shaker. The next day, cells were 200-fold diluted into 4 ml LB media with antibiotics and incubated for 2.5 h at 37°C at 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA). When cells reached OD600 = 0.4, 250 μl of both donor and recipient cells were mixed. Cells were then gently centrifuged (8,000 g, 25°C) and washed with 1 ml of LB without antibiotics four times at room temperature. Finally, cell pellets were resuspended with 50 μl of SOC recovery media and were spotted on a plain LB agar plate (7 μl per spot). Spotted LB agar plates were incubated 5 h at 37°C. Cells were then collected and resuspended into 1 ml SOC recovery media, followed immediately by two additional dilutions (100-fold and 10,000-fold). Then, 75 μl of each diluted cell suspension was plated on LB agar plates with spectinomycin (40 μg/ml) and tetracycline (5 μg/ml). The next day, single colonies were picked from plates and grown in 200 μl M9 media for 5.5 h at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). After the incubation, cells were analyzed with flow cytometry by measuring GFP (FITC-A) and mCherry (PE-Texas RED) expression levels. Only cells that have mCherry but not GFP were used for further analysis to determine the insertion location. For each colony, the insertion location was determined by amplifying the junction between inserted DNA and the neighboring genomic DNA. A randomized primer (oYJP1741: GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC) and an insertion-specific primer (oYJP1745: CTTGGCCTCGCGCGCAGATCAG Martinez-Garcia et al, 2014 ) were used to amplify the junction using two consecutive rounds of PCR amplifications. Each colony was suspended in water and was incubated at 95°C for 10 min to completely lyse cells. A 1.25 μl aliquot of the colony suspension was added as a PCR template to the PCR premix that has 12.5 μl of 2× Phusion High-Fidelity Master Mix (New England Biolabs, USA, M0531), 10 μl of water, 1.25 μl of 10 μM oYJP1741 primer, and 0.5 μl of 10 μM oYJP1745 primers. The PCR products were then Sanger-sequenced with an internal primer oYJP1746 (CACCAAGGTAGTCGGCAAAT) and aligned using NCBI nucleotide blast. Only the insertions with a unique hit were selected for further characterization. The mCherry expression levels and growth phenotypes were characterized for each member of the Tn5 transposon library. Each clone was streaked on LB agar plates with spectinomycin (40 μg/ml) and Tet (5 μg/ml). Single colonies were picked from plates and were inoculated overnight in M9 media without antibiotics for 16 h at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). Cells were diluted 185-fold into 200 μl of fresh M9 media and incubated for 3 h. Cells were diluted again 700-fold into 200 μl of fresh M9 media and grown for 6 h. After incubating for 6 h, 30 μl of cells was added to 200 μl of 1× PBS solution with 2 mg/ml kanamycin (Kan) and fluorescence measured using flow cytometry. The optical density (OD) at 600 nm of the cultures was measured. To do this, 150 μl of the culture was transferred to an optically transparent Nunc™ 96-well plates (Thermo Scientific, USA, 165305). The Hybrid Microplate Reader BioTek Synergy H1 (BioTek Instruments Inc, USA) was used to measure the final absorbance of the culture. The relative growth for each member of the library was calculated by relative growth = ((OD600: Tn5) − (OD600: blank))/(OD600: DH10β Tet) − (OD600: blank)), where OD600: Tn5, OD600: blank and OD600: DH10β Tet refer to OD600 of Tn5 library member, blank M9 media, and E. coli DH10β with the tetracycline marker on the genome, respectively.

    Computational search for putative off-target integrase sites

    To identify potential off-target sites for integrase 2, 5, and 7, the published att B/P sites (Yang et al, 2014 ) (Appendix Tables S5 and S6) were searched for in the E. coli MG1655 genome (NCBI U00096.3) using megablast (Zhang et al, 2000 ) and blastn (Altschul et al, 1997 ). Each site was tested whether it (i) has any matches to the genome via megablast, (ii) covers > 30% of the query sequence via blastn, and (iii) has a match with significant overlap (E-value < 0.1). If any of these criteria were true, the site was rejected.

    Construction of genomic landing pads

    Two methods were used to insert the landing pads into the genome. Two landing pads (#1 and #2) were introduced sequentially using λ-RED recombineering (Datsenko & Wanner, 2000 ). E. coli MG1655 cells harboring arabinose-inducible λ-RED recombinase on a plasmid with a temperature-sensitive origin (pKD46 Datsenko & Wanner, 2000 ) were grown overnight using Falcon 14-ml round-bottom polypropylene tubes (Corning, USA, 352059). Cells were grown in 4 ml LB with Amp (100 μg/ml) at 30°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA). The next day, cells were diluted 200-fold into 25 ml of fresh SOB medium in a nicked-bottom Erlenmeyer flask with ampicillin (100 μg/ml) and 10 mM L-arabinose. Cells were induced for three hours at 30°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA) until they reached OD600 = 0.4. Cells were then centrifuged (4,700 g, 4°C, 10 min) using Legend XFR centrifuge (Thermo Scientific, USA). Cell pellets were then washed with 5 ml of chilled 10% glycerol and spun down again at 4,700 g and 4°C for 10 min. The washing step was repeated two more times using 1 ml of chilled 10% glycerol, and cells were pelleted using a refrigerated benchtop centrifuge (Eppendorf, USA) at 21,000 g and 4°C for 30 s. Finally, cell pellets were resuspended in 500 μl of chilled 10% glycerol. Next, 200 μl of these electrocompetent cells was transformed with 150 ng of landing pad DNA using electroporation (2,500 mA) (Eppendorf, USA) and recovered by adding 1 ml SOC recovery media and incubated at 30°C for 3 h. Transformed cells were then plated on LB agar (2%) with Cm (35 μg/ml) or Kan (50 μg/ml) antibiotics and incubated at 30°C overnight. Integration of landing pads was confirmed by PCR amplification and sequencing of the genomic regions that include landing pads. For Landing Pad #1, amplifying primers oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) and oYJP3437 (AGGCGCTGGAAGCGCGCTTTGTGCTGGAAGATAAG) were used. For Landing Pad #2, amplifying primers oYJP3525 (ACCAATTGGCGCGCGCTTCGCAATAAAATTCCCTTCG) and oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG) were used. After integrating these two landing pads, the temperature-sensitive plasmid harboring λ-RED recombinase was removed by growing cells overnight at 37°C in LB without Amp (100 μg/ml). After the Landing Pads #1 and #2 were successfully integrated, Landing Pad #3 was constructed and integrated using a site-specific mini-Tn7 transposase (Choi & Schweizer, 2006 ). First, the Landing Pad #3 was cloned into plasmid plYJP072 (Appendix Fig S14). Next, E. coli S17-1 λpir electrocompetent cells were transformed with plYJP072 and the resulting strain was conjugated with two different strains for biparental mating. These two strains consist of a strain harboring Tn7 transposase-encoding plasmids and the strain containing Landing Pads #1 and #2 (described above). The conjugated cells were plated on LB agar plate (2%) with Cm (35 μg/ml) or Kan (50 μg/ml) and Tet (5 μg/ml) antibiotics. The insertion of Landing Pad #3 was confirmed by PCR-amplifying and sequencing genomic regions that include the landing pad by using PCR primers oYJP2826 (AGAGATGACAGAAAAATTTTCATTCTGTGACAGAGAAAAAGTAGCCGAAGATG) and oYJP2827 (CCGCGTAACCTGGCAAAATCGGTTACGGTTGAGTAA). After the landing pads were inserted, phage transduction was used to move them into a clean genomic background. Transduction using P1 phage followed a previously published protocol, unless otherwise noted (Thomason et al, 2007 ). To prepare P1 lysate, E. coli MG1655 cells harboring landing pads with three antibiotic markers (Kan, Cm, and Tet) (YJP_MKC172) were cultured overnight at 37°C in LB media with antibiotics. The next day, cells were diluted 100-fold into 5 ml LB supplemented with 0.2% glucose and 5 mM calcium chloride (CaCl2) without antibiotics. After 45 min of incubation at 37°C, 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA), 100 μl of P1 phage stock harvested from E. coli MG1655 was added to the culture and incubated for 3 h at 37°C. Once the culture was cleared, a few drops of chloroform (CHCl3) were added. Cell debris was spun down at 9,200 g for 10 min at 4°C using a refrigerated benchtop centrifuge (Eppendorf, USA). The resulting P1 lysate was further purified through 0.45-μm syringe filter (VWR international USA, 28145-481). To perform P1 transduction, wild-type E. coli MG1655 was grown in LB overnight at 37°C from a single colony. The next day, 1.5 ml of overnight culture was harvested and resuspended in 0.75 ml of P1 salt solution (10 mM CaCl2 and 5 mM MgSO4) (Fisher Scientific, USA). Varying volumes of P1 lysate (100, 10, and 1 μl) were added to the 100 μl of the resuspended cells and were incubated for 30 min at 25°C. The mixtures were transferred into 1 ml of LB supplemented with 200 μl of sodium citrate and were incubated for 1 h at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA). After the incubation, cells were centrifuged at 21,000 g and 25°C for 30 s and were plated on LB agar (2%) plates with antibiotics and 5 mM sodium citrate. Colonies were verified by PCR-amplifying genomic DNA with primers as described above (oYJP3436 and oYJP3437 for Landing Pad #1, oYJP3525 and oYJP3526 for Landing Pad #2, and oYJP2826 and oYJP2827 for Landing Pad #3). After the genomic insertion of landing pads, each landing pad contained a unique antibiotic resistance marker (Cm, Kan, and Tet for Landing Pads #1, #2, and #3, respectively). These antibiotic resistance markers were located between a pair of unidirectional flippase recognition target (FRT) sites.

    RNA-seq

    RNA-seq libraries were prepared following a previously described method (Gorochowski et al, 2017 ). Escherichia coli MG1655 strains with integrated landing pads (YJP_MKC173) were first streaked on LB agar (2%) plates without antibiotics and incubated at 37°C. Single colonies were selected and grown overnight in M9 media without antibiotics at 37°C. The next day, cells were diluted 185-fold into 200 μl M9 media without antibiotics and grown for 3 h at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). After 3 h, cells were diluted 700-fold by adding 4.28 μl of the culture into 3 ml of M9 media without antibiotics. Cells were grown using Falcon 14-ml round-bottom polypropylene tubes (Corning, USA, 352059) in an Innova 44 Shaker (Eppendorf, USA) at 37°C, 250 rpm. After 5 h, cells were spun down at 4°C and 21,000 g for 3 min to collect the cell pellets for RNA-seq library preparation. After discarding the supernatants, cell pellets were flash-frozen in liquid nitrogen for storage at −80°C. Cell pellets were lysed by adding 1 mg of lysozyme, in 10 mM Tris–HCl (pH 8.0) with 0.1 mM EDTA, and total RNA was extracted using PureLink RNA Mini Kit (Life Technologies, CA, 12183020). RNA samples were further purified and concentrated with RNA Clean & Concentrator-5 Kit (Zymo Research, R1015), which was verified by Bioanalyzer (Agilent, CA). Ribosomal RNAs were depleted from RNA samples using Ribo-Zero rRNA Removal Kit for bacteria (Illumina, CA, MRZMB126). RNA-integrity numbers (RIN) were obtained for each sample, and only those samples with RIN > 8.5 were selected for library preparation. Strand-specific RNAtag-seq libraries were created by the Broad Technology Labs Microbial Omics Core (MOC) where uniquely barcoded samples were pooled together to run on two separate lanes of an Illumina HiSeq 2500. After the sequencing runs, reads from both lanes were combined, and the pooled mixture was de-multiplexed into original samples, followed by trimming the barcode tag from each read. Lysozyme, Tris–HCl (pH 8.0), and EDTA that were used for RNA-seq library preparation were purchased from Sigma-Aldrich (L6871), USB (75825), and USB (15694), respectively. Raw sequencing reads were aligned to the reference genomes, and transcription profiles were generated following a previously developed in-house Python script (Gorochowski et al, 2017 ). Briefly, the first step of the process was to generate new reference files for the genome of strains with integrated landing pads. Therefore, for each strain, all integrated DNA sequences were inserted into their corresponding locations on the reference genome of E. coli MG1655 (NCBI RefSeq: NC_000913.3). These new FASTA and GFF files were then used to perform the alignment of raw reads using BWA version 0.7.4 with default settings, resulting in corresponding SAM and BAM files. Next, BAM files were filtered using the “view” command of SAMtools (Li et al, 2009 Barnett et al, 2011 ), and filter codes 83 and 163 were applied to select the reads mapping to the sense strand, and filter codes 99 and 147 were applied to select reads mapping to the antisense strands. Finally, filtered read coverage at each position along the reference sequence was normalized by the total mapped nucleotides across the genome and multiplied by 10 9 to generate the transcription profiles in both forward and reverse directions across the genome.

    Evaluation of thiamine-dependent growth

    Escherichia coli MG1655 and two strains harboring Landing Pad #1 v1 and v2 were grown in M9 media (with thiamine) overnight. The next day, all three cultures were centrifuged (15,000 g, 25°C, 3 min) and resuspended into DI water three times to remove residual thiamine in the media. The OD600 of resuspended cells was measured, and the cells were diluted to OD600 = 0.01. Each dilution was then inoculated into thiamine-free M9 medium, consisting of M9 minimal salt (Sigma-Aldrich, USA, M6030) supplemented with 0.4% glucose and 0.2% casaminoacids (BD Biosciences, USA, 223050). After 6 h of incubation at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA), the OD600 of three samples and a blank sample containing only thiamine-free M9 media were measured using a Cary 50 Bio Spectrophotometer (Agilent, USA).

    Insertion of payloads into landing pads

    Note that an easy-to-follow detailed protocol is provided as Appendix Note S1. The strain containing the empty landing pads was co-transformed with a plasmid encoding three integrases (plYJP053) and a plasmid containing the DNA payloads (plYJP066-KanR, plYJP070-CmR, and plYJP064-TetR). To prepare electrocompetent cells, a single colony was inoculated into 2 ml LB without antibiotics and grown for 12 h at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA) using Falcon 14-ml round-bottom polypropylene tubes (Corning, USA, 352059). The next day, 125 μl of the overnight culture was added to 25 ml SOB medium in a nicked-bottom Erlenmeyer flask. Cells were grown for 2 h at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA). When the early exponential phase was reached (OD600 = 0.3–0.5), cells were centrifuged (4,700 g, 4°C, 10 min) and washed with chilled 10% glycerol three times. After the third wash, cells were resuspended with 200 μl of chilled 10% glycerol. Cells were electroporated with 500 ng of plYJP053 plasmid and 500 ng of the payload plasmids. Immediately after the transformation, 1 ml of SOC recovery media was added to the cells. Cells were then incubated at 30°C for 3 h and plated on LB agar plates (2%) with necessary antibiotics. The insertion into the Landing Pads #1, #2, and #3 was selected with Kan (50 μg/ml), Cm (35 μg/ml), and Tet (5 μg/ml), respectively. To confirm the integration with colony PCR, primers that can amplify the junction between integrated constructs and the adjacent genomic DNA were used. For Landing Pads #1 and #2, oYJP2164 (AATAAACAAATAGGCATGGTCTAAGAAACCATT) was used as a primer that binds to the integrated construct. oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) and oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG) were used as primers that bind genomic DNA adjacent to Landing Pad #1 and Landing Pad #2, respectively. For Landing Pad #3, a forward primer that binds to the end of integrated construct in a forward direction was used with primer oYJP2826 (AGAGATGACAGAAAAATTTTCATTCTGTGACAGAGAAAAAGTAGCCGAAGATG) to amplify the junction between Landing Pad #3 and the adjacent genomic DNA. The amplicon size was confirmed using gel electrophoresis. All three markers can be removed by transforming strains harboring the landing pads with inserted payloads with the pE-FLP plasmid containing a temperature-sensitive origin of replication (St-Pierre et al, 2013 ). To do this, each strain was cultured overnight in 2 ml of LB media with corresponding antibiotics (Cm (35 μg/ml), Kan (50 μg/ml), and Tet (5 μg/ml)) at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker (Eppendorf, USA) using Falcon 14-ml round-bottom polypropylene tubes (Corning, USA, 352059). The next day, cells were 200-fold diluted into 4 ml of LB media without antibiotics and incubated at 37°C and 250 rpm in a New Brunswick Innova 44 Shaker using Falcon 14-ml round-bottom polypropylene tubes (Corning, USA, 352059) for 2 h until reaching OD600 = 0.4. Cells were then harvested with centrifugation (4,700 g, 4°C, 10 min) using a Legend XFR centrifuge. Cell pellets were washed with 1 ml chilled 10% glycerol and spun down using a refrigerated benchtop centrifuge (Eppendorf, USA) at 21,000 g and 4°C for 30 s for three times. Finally, cell pellets were resuspended into 75 μl of chilled 10% glycerol, yielding electrocompetent cells that were then transformed with 20 ng of pE-FLP (St-Pierre et al, 2013 ), followed by recovery in 1 ml SOC media and incubation at 30°C for 30 min. Cells were then plated on LB agar plates (2%) with Amp (100 μg/ml) and incubated at 30°C overnight. The next day, three individual colonies were streaked on LB agar plates (2%) with no antibiotics and incubated at 37°C overnight. Three colonies from each streak were then grown in LB media with four antibiotics (Amp (100 μg/ml), Cm (35 μg/ml), Kan (50 μg/ml), and Tet (5 μg/ml)) at 37°C and 1,000 rpm for 16 h on an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). Cells that did not grow in all four antibiotics were streaked and then used as the final strains.

    Calculation of RPU (relative promoter units)

    Escherichia coli MG1655 containing the RPUG reference promoter (YJP_MKC254) was streaked on a LB agar plate without antibiotics and incubated overnight at 37°C. Single colonies picked from the plate were then inoculated into 200 μl of M9 media without antibiotics and were incubated overnight. All culturing steps were carried out at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). The next day, cells were diluted 185-fold into 200 μl of M9 media without antibiotics and incubated for 3 h. Cells were then diluted again 700-fold into 200 μl of M9 media without antibiotics and were incubated for 5 h. Then, a 30 μl aliquot was transferred to 200 μl of 1× PBS solution with 2 mg/ml kanamycin and evaluated using flow cytometry. To convert the fluorescence of a promoter from au (<YFP>measured) to RPUG, the following equation is used: [(<YFP>measured)-(<YFP>blank)]/[(<YFP>RPU)-(<YFP>blank)], where <YFP>blank is autofluorescence of wild-type E. coli MG1655.

    RPUG-to-RNAP flux conversion

    RPUG was converted into RNAP flux by multiplying a previously calculated conversion factor 1 RPU = 0.019 RNAP/s per DNA (B. Shao, J. Rammohan, D.A. Anderson, N. Alperovich, D. Ross & C.A. Voigt, unpublished data) and the copy number of DNA where the Landing Pad #1 is located. The copy number of the Landing Pad #1 was estimated to 3.5 by comparing the Tn5 expression data for site 7 where Landing Pad #1 is located and the site #3, a site adjacent to the single-copy region of the genome. Note that the same promoter is used for the RPU and RPUG standard cassette, and it is assumed that this promoter produces the same constitutive flux in both locations. Therefore, 1 RPUG was converted into the 0.067 RNAP/s.

    Sensor characterization

    The strain containing the seven sensors in Landing Pad #3 (YJP_MKC174) was transformed with a reporter plasmid containing a promoter fused to yfp (plYJP067-(promoter name)) that is responsive to the seven regulators (AraC, LacI, TetR, CymR AM , VanR AM , CinR AM , and TtgR AM ) and streaked on LB agar (2%) plates with Kan (50 μg/ml). Single colonies were inoculated into 200 μl M9 media with Kan (50 μg/ml) were grown overnight at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates. The next day, cells were diluted 185-fold into 200 μl fresh M9 media without any antibiotics and were incubated for three hours at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). Cells were then diluted 700-fold into 200 μl fresh M9 media (no antibiotics) with appropriate inducers and were incubated for 5.5 hours in an ELMI plate shaker at 37°C and 1,000 rpm using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). Then, either 12.5 mM L-arabinose (Sigma-Aldrich, USA, A3256), 1 mM IPTG (GoldBio, USA, I2481C), 20 ng/μl aTc (Sigma-Aldrich, USA, 37919), 500 μM 4-isopropylbenzoic acid (Sigma-Aldrich, USA, 268402), 200 μM vanillic acid (Sigma-Aldrich, USA, H36001), 10 μM OHC14 (Sigma-Aldrich, USA, 51481), or 1 mM naringenin (Sigma-Aldrich, USA, N5893) was used to induce the sensors. After 5.5 h, 30 μl of cells was added to 200 μl 1× PBS with 2 mg/ml Kan for flow cytometry analysis.

    NOT/NOR gate characterization

    Each strain containing a NOT gate was streaked on the LB agar (2%) plates with Kan (50 μg/ml) and Cm (35 μg/ml) antibiotics. A single colony was picked and inoculated into M9 media with Kan (50 μg/ml) and Cm (35 μg/ml) for overnight culture in an ELMI plate shaker at 37°C and 1,000 rpm. Cell cultures were performed using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). The next day, cells were 185-fold diluted into 200 μl fresh M9 media with no antibiotics and incubated for 3 h in an ELMI plate shaker at 37°C and 1,000 rpm. After the 3 h, cells were then diluted again 700-fold into 200 μl fresh M9 media with no antibiotics and were incubated with inducers for additional 5.5 h in an ELMI plate shaker at 37°C and 1,000 rpm. After the 5.5 h, 30 μl of cells was added to 200 μl 1× PBS with 2 mg/ml Kan for flow cytometry analysis. To measure OD, 150 μl aliquots were transferred to an optically transparent Nunc™ 96-well plates (Thermo Scientific, USA, 165305) to measure OD600 using a Hybrid Microplate Reader BioTek Synergy H1 (BioTek Instruments Inc, USA). To measure the gate response functions, input and output promoter activities measured as median YFP fluorescence were converted into RPUG. The response functions were fit to a Hill equation y = ymin + ((ymax − ymin)/(1 + (x/K) n ), using an in-house Python script.

    Circuit design automation using Cello 2.0

    The Cello 2.0 software (cellocad.org) and code are available open source on GitHub (github.com/CIDARLAB/Cello-v2). Note that the UCF in this paper is designed for Cello 2.0 and will not run with the old Web-based Cello interface. A UCF file (Eco2C1G3T1.UCF.json) (Appendix File S1) was created to encode Hill parameters for NOT gate response functions in the gate library (Table 1), cytometry distributions of each gate, Eugene rules, landing pad location information, and growth assay conditions. Sensor output promoter activities (PBadmc, Ymin = 0.04, Ymax = 3.33 PTac, Ymin = 0.02, Ymax = 4.20 PTet, Ymin = 0.02, Ymax = 5.41 PCymRC, Ymin = 0.19, Ymax = 2.39 PVanCC, Ymin = 0.02, Ymax = 3.79 PCin, Ymin = 0.01, Ymax = 4.38 and PTtgR, Ymin = 0.01, Ymax = 0.22 (in RPUG)), a UCF file, a truth table formulated as a Verilog file, and the growth score cutoff (set to 0.75) were used for each circuit design. Cello 2.0 was run locally using the Cello 2.0 API.

    Genetic circuit construction

    Genetic circuits were first split and cloned into two plasmids, plYJP066 (KanR) and plYJP070 (CmR), that target Landing Pads #1 and #2, respectively, using Type II assembly as previously described (Nielsen et al, 2016 Shin et al, 2020 ). The order of transcription units within a circuit was assigned by Cello 2.0 based on EUGENE rules. In brief, each transcription unit of the circuit was sub-cloned into plYJP080 (AmpR) (Appendix Fig S14 and Appendix Table S6) backbones with p15a origin using Type II assembly with BsaI (New England Biolabs, USA, R3733) and T4 ligase HC (Promega, USA, M1794). The reaction mix was prepared by adding 40 fmol of each DNA fragment, 1 μl of BsaI, 0.5 μl of T4 ligase HC, 1.5 μl of T4 ligase buffer (Promega, USA, M1794), and water up to 15 μl. The reaction mix was then cycled between 37°C (5 min) and 16°C (3 min) for 30 times, resulting in transcription units (in plYJP080 plasmids) that are ready to be used in genetic circuit construction. For every designed genetic circuit, all the used transcription units were assembled into the full circuit using BbsI (New England Biolabs, USA, R3539) and T4 ligase HC (Promega, USA, M1794). Reaction mixture included 40 fmol of each plYJP080 plasmids containing the transcription unit, 1 μl of BbsI, 0.5 μl of T4 ligase HC, 1.5 μl of T4 ligase buffer (Promega, USA, M1794), and water up to 15 μl. The reaction mix was then cycled between 37°C (5 min) and 16°C (3 min) for 50 times for assembly reaction, resulting in two new plasmid backbones plYJP066 and plYJP070 plasmids. These two plasmids were then integrated into the genome as described above. Antibiotic markers were removed by transforming pE-FLP (St-Pierre et al, 2013 ). pE-FLP plasmid was cured by incubating cells at 37°C as previously described (Appendix Fig S14).

    Genetic circuit characterization

    Strains harboring genetic circuit were streaked on the LB agar (2%) plate without antibiotics. E. coli MG1655 wild-type and RPUG standard strains were streaked as controls. Individual colonies were picked from plates and were inoculated into M9 media without antibiotics. Cells were incubated overnight at 37°C and 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). The next day, cells were then diluted 185-fold into 200 μl of fresh M9 media without antibiotics and incubated for three hours at 37°C, 1,000 rpm in an ELMI plate shaker using Nunc™ 96-well plates (Thermo Scientific, USA, 249662). After three hours, cells were 700-fold diluted into M9 media without antibiotics and were induced with appropriate combinations of inducers such as 1 mM IPTG, 12.5 mM L-arabinose, 20 ng/μl aTc, 10 μM OHC14, and 200 μM vanillic acid were used as indicated in Cello 2.0 prediction. After 5.5 h, 30 μl of cells was added to 200 μl 1× PBS with 2 mg/ml Kan for flow cytometry analysis. Median YFP fluorescence from each sample was analyzed using FlowJo (TreeStar, Inc., USA) software and was converted into RPUG.

    Calculation of total RNAP flux

    The input promoter activity (RNAP flux) of every NOT and NOR gate in the 0xF1 circuit was calculated for each state using the Cello 2.0 software package. The total RNAP flux for a circuit was calculated by summing the promoter activities across all the gates in the circuit, including the output promoters of the sensors. For the genome-encoded 0xF1 circuit, we used the UCF file Eco2C1G3T1, the truth table (0xF1.v), and the genome-encoded sensor output promoter activities (described above). The UCF was based on an ordinary additive model for tandem promoter activity and was not encoded with tandem roadblocking rules. For the plasmid-encoded 0xF1 circuit, we used the UCF file Eco1C2G2T2, the truth table (0xF1.v), and the plasmid-encoded sensor output promoter activities (Plux2, Ymin = 0.030, Ymax = 2.234 PTac, Ymin = 0.018, Ymax = 1.689 PTet, Ymin = 0.040, Ymax = 1.967 and PCin, Ymin = 0.005, Ymax = 3.178 (in RPU)). The UCF was encoded with a non-additive tandem promoter model. Once the circuits were designed, the design output files (0xF1_A000_logic_circuit.txt (genome), 0xF1_A001_logic_circuit.txt (plasmid)) were used to calculate total RNAP flux used by the circuit. From each file, the input promoter activity of every NOT and NOR gate in the circuit (second to the last column) was summed to calculate the total RNAP flux. The total RNAP flux calculated for genome-encoded circuits (in RPUG) was then divided by 6.33 (Appendix Fig S4) to convert the RPUG into RPU. The total RNAP flux for a plasmid-encoded circuit was calculated in RPU.

    Long term stability test

    The plasmid-encoded 0xF1 circuit was designed using the UCF for the p15a plasmid (Eco1C2G2T2) and was constructed in E. coli DH10β (Nielsen et al, 2016 Shin et al, 2020 ). The E. coli MG1655 strain harboring the genome-encoded 0xF1 circuit was streaked on LB agar (2%) plates with Kan (50 μg/ml) and Cm (35 μg/ml) antibiotics and grown overnight. The E. coli DH10β strain harboring the plasmid-encoded 0xF1 circuit was streaked on LB agar (2%) plates containing Kan (50 μg/ml) and grown overnight. For each, three colonies were picked and grown in M9 media without antibiotics. Every day, each culture was diluted 10 4 -fold into 500 μl of fresh M9 media in 96-deep well plates (USA Scientific, USA, 1,896–2,000) with the inducer combination indicated in Fig 5. After incubation for 8 h at 37°C and 900 rpm in a Multitron Pro Incubator Shaker (In Vitro Technologies, VIC, Australia), 30 μl of cells was added to 200 μl 1× PBS with 2 mg/ml Kan for flow cytometry analysis and 100 μl of cells was mixed with 80% autoclaved glycerol (VWR chemical BDH1172-1LP) and stored at −80°C. Another aliquot was diluted 100-fold into fresh media with the same inducer combinations and incubated overnight. The cycle continued for 12 days by repeating this protocol. To measure the OD600 of genome and plasmid-encoded circuits, individual colonies from the streak were inoculated into M9 media and incubated overnight at 37°C and 1,000 rpm in an ELMI plate shaker. Cells harboring plasmid-encoded genetic circuits were incubated overnight with Kan (50 μg/ml). Genome-encoded circuits were incubated overnight without antibiotics. The next day, each culture was diluted 185-fold into 3 ml of fresh M9 media and was grown for 3 h at 37°C and 250 rpm in an Innova Shaker. Three hours later, the OD600 of each culture (OD600) was measured using a Cary 50 Bio Spectrophotometer (Agilent, USA). The measured OD600 was used to calculate the amount of the sample required to transfer the same number of cells to the second dilution. Cells were diluted

    700-fold into 3 ml M9 media with appropriate inducers and were grown for 5.5 h at 37°C and 250 rpm in an Innova Shaker. The growth of cells without a circuit was determined using either E. coli MG1655 with empty landing pads (YJP_MKC173) or E. coli DH10β harboring a p15a plasmid with a Kan (50 μg/ml) resistance gene (pYJP018).


    Bacteria

    Binary fission is the splitting of a parent cell into two daughter cells it is asexual reproduction in prokaryotes.

    In bacteria, genetic recombination can occur in three ways.

    1. Conjugation

    2. Transformation

    3. Transduction

    III. Prokaryotic Nutrition

    Autotroph ( Chemotroph or Photosynthetic ) / Heterotroph

    Mutualists (symbiotic) nitrogen‑fixing Rhizobium bacteria / Gut bacteria in humans

    IV. BACTERIA CLASSIFICATION

    1. Three basic shapes: coccus / bacillus / spirillum

    2. Those shapes can be organized into

    staph = clusters / strep = chains

    A. Bacillus B. Streptococcus C. Staphylococcus D. Diplococcus E. Spirllum F. Vibrio

    3. Gram Stains

    Used to identify bacteria / Gram Positve = dark purple / Gram Negative = pink


    Characterization of recombinant E. coli expressing arsR from Rhodopseudomonas palustris CGA009 that displays highly selective arsenic adsorption

    Innovative methods to lower arsenic (As) exposure are sought. The As regulatory protein (ArsR) is reported of having high affinity and specificity to arsenite [As(III)]. Rhodopseudomonas palustris CGA009 is a good model organism for studying As detoxification due to at least three ars operons and four diverse arsRRP1–4 on the genome. In this study, four Escherichia coli harboring arsRRP1–4 derived from CGA009 were engineered and tested regarding their As resistance. The results showed that E. coli (arsRRP2) displayed robust As(III) resistance, and its growth inhibition rate was only 2.9% when exposed to 3.0 mmol/L As(III). At pH 7.0, E. coli (arsRRP2) showed an enhanced As adsorption capacity. As(III) (2.32 mg/g (dry weight, dw)) and 1.47 mg/g arsenate [As(V)] was adsorbed representing a 4.2-fold and 1.3-fold increase respectively compared to the control strain. The adsorption process was well fitted to Langmuir isothermal mode. E. coli (arsRRP2) (1.0

    82.2% of As (III) when exposed to 10 μg/L As(III). No increase in absorption to copper(II), zinc(II), chromium(III), and lead(II) could be detected. Our studies revealed that arsRRP1–4 from CGA009 could confer As(III) resistance E. coli (arsRRP2) displayed the highest As resistance, selectivity, and adsorption capacity within a wider pH (5.0

    15.0 g/L NaCl) range, especially important as it could remove As(III) from low concentration As-containing water.


    Conclusions

    Studying the physiological and metabolic responses of an adapted E. coli culture to substrate perturbations, highlights parameters to take into account for metabolic engineering and process design in relation to large-scale reactor operation.

    Cells responded immediately to an excess of substrate, by increasing their uptake rate and consequently the intracellular fluxes in tens of seconds. Carbon was stored in intracellular intermediates, during substrate feast and was consumed during a famine phase.

    Despite, the highly changing dynamics, energy charge homeostasis was observed, as a remarkable fitness characteristic of the response to perturbations, indicating rapid metabolic regulation.

    More important and highly relevant to industrial fermentations, was the 30% decrease of the biomass yield, occurring during the intermittent feeding, compared to a reference steady-state. Energy-spilling, was therefore, a trade-off for the adaptation of the microorganism in the dynamic environment, seeking for robust growth.

    The obtained results revealed some reasons for the reduced performance of cell factories during scale-up. E. coli responds to stress, induced by substrate gradients, by launching a specific metabolic strategy. In order to improve productivity cost-effectively in large-scale bioprocesses, we need to further identify the mechanisms behind stress adaptation, limitations in substrate uptake and respiration, potential energy-spilling pathways and optimal growth targets of the cells, combining multi-omics approaches.