Information

Why does underwinding create topological strain of DNA?

Why does underwinding create topological strain of DNA?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I am currently studying the supercoiling of DNA. I understand why overwinding would create additional strain for two attached strands of DNA, but I really don't get why underwinding would create strain and thus supercoiling. If anything it seems that the strands would just separate and strain would be relieved from any DNA helix. If someone would care to explain, that would be great!


The double helical structure of DNA with ~10.5 bp/turn is thermodynamically favorable. Any perturbation from this results in strain. Thus, if DNA is under wound, it is favourable for it to adopt a negative supercoil to return to ~10.5 bp/turn.

That said, negative supercoiling and DNA melting are in fact in some kind of equilibrium. This is important for processes such as transcription and replication which require ssDNA.


Good question! I didn't know the answer either, but I think I have a good idea after thinking of DNA as a normal rope.

This answer helped me put it into perspective: https://physics.stackexchange.com/questions/30871/what-prevents-a-natural-fibers-rope-from-untwisting-when-it-is-elongated

As well as the video linked to in this answer: What is positive and negative supercoiling?

Basically, imagine you have two long strings, then you twist them around each other (DNA helix structure), each twist is called a coil.

Now tie each end to opposing hooks (imagine the hooks located on each side of a doorframe at equal height) without allowing your two strings to untwist.

Once your double stranded rope is secure (the hooks it's tied to represent a point opposite the unwinding site on the circular DNA), pull the two intwined strings further and further apart from each other at the middle of the rope. (This is what underwinding does)

Because each end is secured, it can't untwist, so it supercoils. By pulling the strings apart in the middle, you didn't untwist the coils, you just pushed them closer together, squishing them 'tighter' (stressed) on each side.


Visualization of unconstrained negative supercoils of DNA on polytene chromosomes of Drosophila

Kuniharu Matsumoto, Susumu Hirose Visualization of unconstrained negative supercoils of DNA on polytene chromosomes of Drosophila. J Cell Sci 1 August 2004 117 (17): 3797–3805. doi: https://doi.org/10.1242/jcs.01225

Bulk DNA within the eukaryotic genome is torsionarily relaxed. However, unconstrained negative supercoils of DNA have been detected in few local domains of the genome through preferential binding of psoralen. To make a genome-wide survey for such domains, we introduced biotinylated psoralen into Drosophila salivary glands and visualized it on polytene chromosomes with fluorescent streptavidin. We observed bright psoralen signals on many transcriptionally active interbands and puffs. Upon heat shock, the signals appeared on heat-shock puffs. The signals were resistant to RNase treatment but disappeared or became faint by previous nicking of DNA or inhibition of transcription with α-amanitin. These data show that transcription-coupled, unconstrained negative supercoils of DNA exist in approximately 150 loci within the interphase genome.


Lecture 24: AIDS

Download the video from iTunes U or the Internet Archive.

Topics covered: AIDS

Instructors: Prof. Robert A. Weinberg

Lecture 10: Molecular Biolo.

Lecture 11: Molecular Biolo.

Lecture 12: Molecular Biolo.

Lecture 13: Gene Regulation

Lecture 14: Protein Localiz.

Lecture 15: Recombinant DNA 1

Lecture 16: Recombinant DNA 2

Lecture 17: Recombinant DNA 3

Lecture 18: Recombinant DNA 4

Lecture 19: Cell Cycle/Sign.

Lecture 26: Nervous System 1

Lecture 27: Nervous System 2

Lecture 28: Nervous System 3

Lecture 29: Stem Cells/Clon.

Lecture 30: Stem Cells/Clon.

Lecture 31: Molecular Medic.

Lecture 32: Molecular Evolu.

Lecture 33: Molecular Medic.

Lecture 34: Human Polymorph.

Lecture 35: Human Polymorph.

It comes acquainted with different antigens.

And recall that what we were talking about was the following, that there were several kinds of phagocytic cells. Phagocytic cells are cells that chew up other things, both macrophages and even more frequently, dendritic cells, many of which hang around lymph nodes by the way. They process antigens into oligopeptides. The oligopeptides get presented on the surface of these cells. Let's say, here's a macrophage, in the form of through the class 2 MHC molecules which are displayed on the surfaces of the cells. And, here's a typical oligopeptide that has been chewed up from one of the antigens that was previously internalized, eaten up by the macrophage, a dendritic cell, and then presented on the surface. Recall, then, we have an itinerant macrophage or dendritic cell. Could we turn up the sound just a little, just a notch? Thank you. And this dendritic cell or macrophage, I'll just call it a macrophage for the moment, is then moving largely through the lymph nodes, but wherever it moves, it's carrying along this oligopeptide.

And recall that we liken this voyage of it to a Middle Eastern market where there's a lot of bazaar stalls on either side of the road, and where instead of the usual male merchants, there's a lot of female merchants hanging out. And these females are called T helper cells. They're a kind of T lymphocyte or T cell. TH refers to their function. And here, all of these T helper cells, I'll indicate each of them here as a pink circle.

And these T helper cells display on their surface to blow them up to a large size a T cell receptor that is organized much the way immunoglobulin molecule and antibody molecule's organized.

That is to say, it has variable and constant regions.

It's generated through the rearrangement of antibody-like genes.

But it only functions, this T cell receptor or as it's called in the trade the TCR, only functions to sense the presence of antigens in the extracellular space. In fact, it senses antigens in the context of the MHC class 2.

So here's an MHC class 2 molecule. We can think of the MHC class 2 as being a hand, which is presenting this oligopeptide.

I haven't drawn a hand, but you can pretend it's a hand.

And this MHC class 2 is being presented by either a macrophage or a dendritic cell. And recall, we talked about the voyage of this macrophage or dendritic cell through this street here, and all these T helper cells are kind of lazily waiting along on the sidelines looking at what this phagocytic cell is hocking.

Most of the T helper cells are totally uninterested in what he's hocking. But one of them is struck. It's love at first sight, this one over here, let's say, because her T cell receptor precisely recognizes this oligopeptide in the context of the MHC class 2 molecule. And, obviously I would like to draw thousands of these T helper cells here, each of which bears a different T cell receptor on her surface. I'm only showing one.

And recall that after they make this encounter, the T helper cell gets all excited because she says, oh, I can't believe it, you have exactly the oligopeptide that's recognized by my receptor. And so, she gets all excited, and what she does is she proliferates because that's about all that excited cells can do. Well, they can do other things, but again, we don't want to talk about it. Anyhow, so this particular T helper cell undergoes a clonal expansion, and is now activated, i.e. activated not only psychologically but physiologically by having encountered the antigen-presenting cell. The MHC class 2, the macrophage is called an antigen-presenting cell. It's using its MHC class 2 molecules to do so. Macrophages and dendritic cells are pretty much similar in this respect. Macrophages go all over the body in the tissues.

Dendritic cells tend to inhabit the lymph nodes. But from the point of view of our discussion today, we can imagine that they're functionally essentially equivalent. And having said that, now these T helper cells go looking for a congenial B cell.

So, now we have a third actor in the drama, and the congenial B cell looks like this. And, the B cell has the following thing. The B cell has also on its surface, MHC class 2 molecules, which can be used in antigen presentation. But the B cell has an addition as we said last time, already, on its surface, IGM molecules. An IGM is a brand of antibody.

Keep in mind that really one of the paradoxes that we haven't really fully settled on is the following question or the following issue.

How is it that when a B cell sees a cognate antigen, why does it get stimulated? In other words, what is it that induces the B cell to start proliferating?

Here's another version of what I showed you last time, where a B cell which makes the right antibody gets stimulated, but a B cell that doesn't does not get stimulated.

And that's the issue we're wrestling with right now.

So here on the surface of this B cell is an IGM molecule.

Keep in mind an IGM molecule is an antibody molecule.

Immunoglobulin means IG. It's the earliest form of antibody that's made. Once again, it is antigen specific.

Its variable region has been rearranged through the fusion of different VDJ segments and somatic hypermutation.

And, this B cell has a very interesting property.

This is a naïve cell, and what this B cell does is as follows. It moves around the body, and if this B cell happens to find an antigen, which is recognized by its antibody, the IGM antibody.

Then the B cell will bind this antigen using its IGM molecule to do so. More importantly, it will then internalize this antigen and chew it up into little pieces, and then present it on it surface via the MHC class 2 molecule. So, let's just review what we've been saying. Before, we were talking about macrophages and dendritic cells, which gobbled up whatever they could, processed whatever they gobbled up, and put it on the surface again as MHC class 2, and therefore the macrophages and the dendritic cells are really like sewer rates. They'll just chew on anything and they'll put it on their surface. They're totally promiscuous in what they present on their surface. But here, the B cell is doing something rather similar. But the B cell isn't presenting whatever it happens to stumble across on its surface.

The B cell is extraordinarily selective at what it presents on its surface. It only presents on its surface those antigens which are recognized by its IGM molecule. So here, it uses its IGM molecule to grab hold of this antigen. It internalizes the antigen, and then presents it back on the surface as an MHC class 2 molecule.

So, there's a profound contrast in the behavior of these two kinds of antigen-presenting cells. The macrophages and dendritic cells, they just gobble up everything, and whatever they find, they put on their surface. They don't care with MHC class 2.

The B cell is extraordinarily selective and specific.

It will pull in not through regular phagocytosis. It will pull in using its IGM receptor, specific antigens that are recognized by its IGM molecule, and then externalize it using its MHC class 2 molecule to do so. Let's go back to the drama of the activated T helper cell, and here's the activated T helper cell. We'll draw her in pink. The T helper cell has just had an encounter with a macrophage, or dendritic cell. And, she's just left this marketplace. And now, she's very excited.

So here is her T cell receptor. And she's very excited. She's putting out all kinds of growth factors and multiplying all over the place. And she starts looking again now for a B cell with which he can react. Now, most of the B cells in the body will not have an epitope that she recognizes.

Most of the B cells in the body will have picked up other kinds of things that happen to recognize by their T cell receptor, and will present it on the surface. A rare B cell will happen to internalize an antigen, and put on the surface, which is the same antigen that was recognized previously in the previous encounter. And so, now this T helper cell goes around looking for an attractive male. What's an attractive male for her? An attractive male for her is one whose MHC class 2 molecule is recognized directly in the context, and this oligopeptide is recognized by her T cell receptor. And so, she'll come over here and she'll say excitedly to the B cell, you can't believe what just happened.

She will say, I was just there. I just went through the market.

I was sitting there in the marketplace, and along came a macrophage, and presented me with an oligopeptide that exactly fit in my T cell receptor. And now, she says excitedly, here I find a B cell has exactly the same oligopeptide presenting it to me. Isn't that a coincidence? And the B cell says, come on lady, get to the point. And she says, I just had an encounter with a macrophage dendritic cell. I recognized the same oligopeptide in the macrophage dendritic cell that you have.

And, the B cell says, well, I guess this must be some kind of meaningful encounter, and so these two cells get together.

And what happens now is that the T cell, having recognized the oligopeptide, presented on the surface of the B cell now begins to send out signals to stimulate the B cell to proliferate.

And this B cell now begins to proliferate. And this B cell now begins to proliferate, as is indicated on this overhead, and eventually it starts making IGM molecules. It makes more of them, and then through the class switching that we talked about last time, it'll make eventually IGG secreted antibody gamma globulin molecules.

So you see here the three essential cell types that participate in this.

And why is it so complicated? Because it's extraordinarily important that the immune system doesn't inadvertently make antibodies that are inappropriate to express, because as we said before, if a certain of those antibodies and indeed possibly many of them could be autoreactive. And what do I mean by autoreactive?

I mean reactive with self. They could be antibodies that react with one's own tissues. And in so doing, they could create series kinds of autoimmune diseases. So, we have this sequence of failsafe reactions. So, when finally the decision for the B cell to get activated depends on a previous encounter with the same oligopeptide by a macrophage or dendritic cell, the T helper cell acting as an intermediary and now activating the B cell, once the T cell tells the B cell that the T cell has had a previous encounter with exactly the same oligopeptide, on that occasion being presented by a macrophage or dendritic cell.

And that is actually the mechanism by which we get this clonal expansion of B cells in the immune system, and ultimately how we get the productive antibody molecules. I mean, this is the image I showed you earlier, but I never really explained to you what the biology behind that is. I just said that antigen encounter on the part of the B cell causes that B cell to enjoy clonal expansion. And now, we've gone through the detail of deciding how three different cell types interact, collaborate with one another to create the antibody response because this B cell then goes on to produce IGM as it already is doing, and then eventually IGG, and possibly a series of other immunoglobulins, IGE and IGA which have other purposes. Now, all of this actually is an important prelude to our main topic of discussion today, which is the disease of AIDS. And, let me just add one other detail to this because the ability of a T helper cell to recognize MHC class 2 molecules depends on another cell surface molecule expressed by the T helper cell. And this other T cell surface molecule is called CD4. CD4, we don't have to worry of what it stands for. CD4 is not an antigen specific receptor. CD4, instead, only recognizes MHC class 2 molecules no matter what they're carrying.

So, there are MHC class 2 molecules which I've implied to you can carry thousands of different oligopeptides. CD4 doesn't care what's being carried by the MHC class 2. It just binds to MHC class 2 molecules, thereby telling the T helper cell that an encounter has been made with an antigen-presenting cell.

So, the ligand for CD4 is part of the MHC class 2 molecule.

Now, that all leaves us in a very nice segue to the whole disease of AIDS. Let's just remember how the disease of AIDS was discovered.

In 1981, there were a group of five young men who were all subsequently determined to be gay, be homosexual, who were discovered in San Francisco to have a very unusual kind of immunodeficiency.

They all had night sweats. They got different kinds of otherwise unusual diseases. For example one of the things they got was a disease called Kaposi's sarcoma, which was otherwise known only in old southern Italian and Jewish men, Kaposi's sarcoma.

But these were young men, and they were neither southern Italian nor Jewish. They got pneumocystis carinii, which is a microbial infection of the lung. And, in fact, they got all kinds of herpes virus infections.

And they were all seen in a cluster by an alert physician who saw something very unusual, and therefore said, perhaps correctly, that they had acquired immunodeficiency.

Now, this acquired immunodeficiency is a syndrome.

A syndrome, by the way, for your information, is a whole collection of symptoms that appear together. That's what a syndrome means. So, this term AIDS came from the fact that they had a whole series of symptoms. And, this was an acquired immunodeficiency rather than a congenital immunodeficiency rather than a congenital immunodeficiency because given the complexity of the immune system, you can imagine correctly that there are a lot of people in the world who were born with congenitally defective immune systems that are immunodeficient from birth because there's so many different proteins involved in regulating all of these different immune responses. But this was really different.

It was an acquired immunodeficiency. It was seen in a very special subgroup, and so the race was on over the next two years to figure out what was going on.

Now, by coincidence, starting in 1970-'71, retrovirus research had begun. And as it turned out, retrovirus search, President Nixon's war on cancer, retrovirus research was motivated largely by the notion that human cancers are caused by retrovirus infections. And, that led to the war on cancer.

And the notion behind the war on cancer was totally wrong because it turns out that only a minute fraction of human cancers have anything to do with retrovirus infections, although as we've said earlier, retroviruses proved to be very important tools experimentally for discovering proto-oncogenes and oncogenes in the genome.

But if you ask, what fraction of human cancers are actually due to a human being infected by a retrovirus?

It's almost zero. It's a small fraction of a percent.

Nonetheless, in the 1970s, there was an enormous effort made in trying to figure out all of the biology of retroviruses.

And by the late 1970s, people concluded this was very interesting science. Indeed, proto-oncogenes and oncogenes were discovered, but that it was pretty irrelevant to understanding directly how human cancer arose, which human cancers could be explained rather by somatic mutations in the genome.

In 1981, the AIDS infection arose. And, what happened subsequently is that there was a race on to try to find out what the infectious agent was because it seemed to be an infectious agent.

It was being spread from one gay young man to another that was used to induce this. And within two years, by 1983, the culprit retrovirus had been found. I'm telling you this long song and dance to give you the following insight.

If there had not been a decade of earlier retrovirus research, it could have taken the scientific community many, many years to figure out what was causing AIDS. But through happenstance, through a sheer stroke of luck, by the time the first individuals suffering from AIDS were encountered in '81, there was already a backlog of a decade's worth of detailed retrovirus research, which made it possible to discover, to discern almost within months what was causing it.

And, the agent that was causing it was a retrovirus.

The retrovirus here has indicated, very schematically, these artists' drawings never have any resemblance of what things really look like.

And if they do, it's only by coincidence. Let me borrow your laser pointer here for a second. So here, and this is what a retrovirus looks like just to give you a feeling.

In the center, there are two single stranded RNA molecules. The virus is diploid. There's two copies of the genome for reasons we still don't understand.

Surrounding it is a so-called nucleocapsid, which is responsible for protecting the RNA molecules. These two pink dots are reverse-transcriptase molecules because as you'll recall, when retroviruses infect a cell, they carry the enzyme with them into the cell. You could say, why don't they make it after they get into the cell? And it's not totally obvious why, but this is what they do. There's another shell of proteins out here.

And then, beyond that is a lipid bilayer. And this lipid bilayer is, as you may recall, stolen from cell from which the virus is protruding because if you look at retrovirus-infected cells, here's the plasma membrane of a retrovirus-infected cell.

Here you can see a nucleo-capsid forming with the RNA molecules.

And this shoves its way, protrudes its way through the plasma membrane, stealing a patch of plasma membrane from the infected cell, and at the same time this part of the plasma membrane carries with it viral glycoproteins. And viral glycoproteins, they're obviously glycosylated, as are many other extracellular proteins. And in this case, they're indicated with these yellow ovals, and these viral glycoproteins are used to attach to subsequently infected cells so what happens is that when the retrovirus gets out of the cell, I'll draw it again schematically here, it has this glycoproteins coat on it with the plasma membrane, and it uses these glycoproteins spikes.

I just won't put the yellow ovals on them, to attach to cells which need to be infected. So, here's a target cell that needs to be infected. So, the target cell, and how does this virus know how to attach to this cell and not to other cells? Because on the surface of the target cell are certain cellular proteins, which are used for normal cell physiology, which are there, and which the virus has opportunistically developed an affinity for. So here on the surface of a target cell might be a normal cellular protein to which the viral glycoprotein combined. Or, if you want to get technical, this enables the virus particle to adsorb, to attach to.

Notice the D here rather than the B, to adsorb to the surface of the target cell. Importantly, what's the cell surface protein of the target cell to which HIV virus adsorbs? It's our old friend CD4.

I.e. the HIV particle likes to adsorb, preferentially adsorbs to the surface of cells that express the CD4 molecule on the surface.

Note, by the way, that just five minutes ago, we described a totally different function of CD4. CD4 over here was said to represent the means by which the T helper cell can recognize MHC molecules being displayed on the surface of either of these dendritic cells or B cells. But here we see CD4 in a totally different context. Here, the CD4 represents the docking site to which the viral glycoprotein can attach, enabling the virus, which came to be called human immunodeficiency virus. In fact, the virus was discovered by two groups simultaneously, one of them called HDLV-3, the other called lymphadenopathy virus. The first group was American.

The second group was French, and they allowed Herald Varmus, one of the co-discoverers of the proto-oncogene to act as sort of the judge to see what it would be called because there was great political tension. Would it get the American or the French name depending on which of the two warring scientists, and they were warring, could claim discovery? So, he had a Solomonic decision.

He decided to name it human immunodeficiency virus.

That was a compromise. And by the way, some people in less than charitable mood say, well, of course he named it human immunodeficiency virus because those are almost his own initials.

But, I think that's unfair. These were his initials.

Here's human immunodeficiency virus. He named it for a perfectly good reason. Anyhow, that broke the Franco-American diplomatic tension, and now one began to realize that HIV or human immunodeficiency virus attacked T helper cells and preferentially infected T helper cells by virtue of the ability of the virus particle to dock itself to the CD4 molecules presented on the surface of these cells. By the way, what happens afterwards, after the virus becomes adsorbed to the surface of an infectable cell such as a T helper cell. So, here's the virus particle.

Here's the surface of a T helper cell. What happens then is these two lipid bilayers fuse with one another so that now they became one, and now the internal contents, the nucleocapsid which contains the RNA and the reverse transcriptase now has direct topological access into the cytoplasm of the cell. In fact, the glycoprotein, the yellow ovals there of human immunodeficiency virus actually had two functions. First, it specifically recognizes the CD4 molecules to which it then anchors or adsorbs the virus particle. And secondly, it also has fusing functions, i.e. it's capable of causing the lipid bilayer of the virion, or the virus particle, to fuse with that of the plasma membrane of the infected target cell. And, once it's in there, then the virus can begin to do its replication. Now, the replication of the HIV virus was already pretty well understood by the time that HIV was discovered in 1982-'83 because of this backlog of retrovirus research. And just to review for you how retroviruses replicate, RNA is put into the cell, single stranded RNA. It's called plus strand RNA because it is of the same polarity of the same strandedness as messenger RNA.

If it were complementary to messenger RNA, then it would be called minus strand RNA. This is reverse transcribed by the reverse transcriptase, which is carried into the cell.

RT stands for reverse transcriptase. And now, one gets a double stranded DNA molecule, a copy of the virus. And this DNA copy is sometimes called a provirus. And just to review, this provirus is then subsequently integrated into the chromosomal DNA of the cell. So, here's the provirus.

Here's the chromosomal DNA. And then, this integrated provirus then serves as a template for making progeny plus-stranded RNA.

And this progeny plus-stranded RNA, which is, by the way, forward transcribed by RNA polymerase too, which does the bulk of the heavy lifting in terms of making RNA in the nucleus, this plus-stranded RNA can have two functions recall. One, it can serve as a template on ribosomes for making viral proteins such as the viral capsid proteins.

And two, the plus stranded RNA can in turn be encapsidated, i.e. it can become packaged. Encapsidate equals, it can become packaged by the viral proteins to make progeny virus particles, which can then bud, as I've indicated here, from the surface of the infected cell. And in fact, we can imagine three classes of viral proteins that are required for replication.

First is the reverse transcriptase, which is encoded by the viral RNA.

Second are the capsid proteins which carry the RNA, and third are the viral glycoproteins up here which these glycoprotein spikes which are trans-membrane proteins that protrude from the virion, and allow the virion to adsorb to the surface of infected cells. It turns out that this virus has become an extremely difficult virus to deal with. For most viruses that we have encountered over the last 100 years, one has had great success in making vaccines against these viruses including, as we discussed in great detail, poliovirus.

In fact, for smallpox, another virus, the vaccine effort was so successful that about 20 years ago, the last case of smallpox finally occurred in Eritrea in northeast African when some herdsmen had the last documented case. And since that time, there have been no documented cases of smallpox in the wild, and there's only two or three stocks of smallpox virus surviving.

One of them is in some type of research center is Moscow, and the other is probably in the Communicable Disease Center in Atlanta, Georgia. And, there's been great debate, by the way. Should one get rid of those surviving stalks, or should one keep them for research? By now, you guys aren't vaccinated against smallpox because nobody gets it anymore, and there's a certain risk of getting a small pox vaccine.

I am, so I'm not worried, but maybe you should be because starting about 20-25 years ago, one stopped vaccinating people against smallpox because it just doesn't seem to be necessary.

Why give them the risk of having some disease which happens in one out of a million vaccinees (sic) instead of just leaving them unvaccinated? Well, I digress. Back to HIV, the fact is we've had enormous lack of success in making a good kind of vaccine against HIV, and why is that?

Well, one of the critical things is that HIV is attacking and replicating in the T helper cells, and the T helper cells it turns out are the lynch pains of the immune response. Keep in mind that the T helper cells that I've shown you in this diagram over here represent these critical cellular messengers between the dendritic cells and the macrophages on the one hand, and the B cells on the other.

You wipe them out, and the ability to make new antibodies is totally compromised. It turns out the T helper cells can also help to make another class of cells which are called cytotoxic T cells, another kind of T cell, cytotoxic, and these cytotoxic T cells have on their surfaces T cell receptors, which they can use to recognize infected cells, and kill infected cells.

So, the cytotoxic T cells aren't involved in making antibody responses at all. The cytotoxic T cells are involved in recognizing cells that are expressing unusual or foreign antigens on their surface, and killing those cells. That's the function of the cytotoxic T cells. Obviously, it's quite different from the helper T cells. But once again, the activation of the cytotoxic T cells, and empowering them to make these attacks on abnormal cells depends on the helper T cells.

Once again, the helper T cells represent the lynch pins, the keystones, of the immune response. But, because of this tropism, and when I use the word tropism, I mean because of the desire of the virus to phase towards and infect a certain subset of cells in the body, this tropism of HIV for infecting and killing helper T cells, the production of antibodies is strongly compromised on the one hand, and the production of cytotoxic T cells is compromised on the other.

There's another aspect of HIV infection which is also very insidious, and that's the following. It turns out that the body can initially make an immune response against an infecting HIV particle.

And here's kind of what things look like. I hope this shows up here.

Who could lend me a laser pointer again?

Excellent, thank you. OK, so here's what happens.

And, there's two graphs here. On one hand are the cytotoxic T cells, and their level is shown on the solid line here.

So, look at the course of infection. It's plotted here in weeks and years. If you see what happens in a primary HIV infection, and here on the right on this ordinate here is the viral titer indicated on a log scale. So, this is a semi-log graph for the viral titer. And what you see over here is that when you initially infected it, there's an enormous burst of viral titer.

It goes up by four or five orders of magnitude, and then it falls down dramatically by two or three orders of magnitude. And it goes on, and it remains depressed by two or three orders of magnitude below its initial height for a number of years.

What's going on then? The immune system has come to grips with the presence of the HIV virus, and begins successfully to try to eliminate it. How does the immune system eliminate HIV?

By two mechanisms. First of all, the immune system makes neutralizing antibodies of the sort that float through the serum, and are able to glom onto the virus particle, attach to the virus particle, and thereby prevent it from being infectious.

And secondly, as I mentioned last time, the immune system also can recognize virus-infected cells and kill them. And by killing a virus-infected cell, the immune system prevents that cell from continuing to function as a factory for putting out new virus particles. So, there's two ways by which virus particles are eliminated, but note here that the virus infected cell which is critically important among all the cell types in the body are the T helper cells.

So, certain components of the immune system are killing the T helper cells that are involved in harboring and producing HIV virus.

So, there's an auto destruction on the part of the immune system.

Look, at the same time, at the titer, at the number of CD4 cells, and they're indicated here on the left ordinate, in this case, cells per microliter. CD4 cells originally started up here. They go down by a factor of two or three for the first weeks, and then over a period of years there's this ongoing struggle between the HIV particle and the immune system as the number of CD4 cells, and the CD4 cells we've said before, the CD4 positive cells are these T helper cells as the number of these cells per microliter of blood progressively declines further and further and further. And finally, the number of CD4 positive cells, i.e. T helper cells, gets so low that the body is totally overwhelmed, and the patient then dies of an opportunistic infection.

What do I mean by an opportunistic infection? Well, what I mean is that we are surrounded all the time by all kinds of microbes, which given the chance will kill us within a couple days.

Keep in mind, I told you that there are in your gut, as many bacterial cells as there are the rest of your body.

And some of these bacteria are really nasty. I remember, my grandfather got kicked in the belly by a horse, and three days later he was dead. Why? Because some of the bacteria got out of his gut, got into his peritoneal fluid cavity, and gone. This was the pre-antibiotic era, by the way, never new him very well because he died in 1916.

I'm just telling you that your gut is full of all kinds of nasty thing on your skin. Not just on my skin, but on your skin there are billions of staph aureus bacteria. They're just waiting to cause you problems. Don't look. It's OK.

Don't look too closely. They're just waiting to cause a nasty infection as well. Everyday we breathe in all kinds of awful microbes, fungi, and all these kinds of things including pneumocystis. And, rarely do we get sick because of the extraordinary competence of the immune system to respond to such a diversity of infectious agents, and to hold them at bay.

In the 20th century, the percentage of people who die of infectious diseases has plummeted both because of the immune system and because we're eating healthier up to a point, and because of antibiotics and antifungals. But if the immune system is defective, all the antibiotics in the world, and all the antifungal agents can't save a patient if their CD4 cells get down very, very low because these antifungals always worked as collaborators with the immune system.

They get rid of a bulk of the infection, but the immune system has to wipe out the residue. And what you see here is a struggle going on for a period of three, four, five, six years where the viral titer is successfully held low, and then all of a sudden as the immune system weakens the viral titer goes up to high levels, wipes out the residual T helper cells, and death invariably ensues. Now, I've given you one reason why the immune system can't deal with this virus, because virtually all other viruses attack various tissues throughout our body, but they don't attack the immune system itself.

Here, we're having a virus which is attacking the defense of the body, that is to say, the immune system. So, one reason is the continuing depletion of the T helper cells. They can regenerate themselves for a period of time, very impressively long period of time, four, five, six, seven years. But ultimately, they get worn out, they die. Another reason is this is antigenic variation. Now, if you look at the retrovirus particle, what you see is on the surface the glycoprotein.

It's right here. And, the glycoprotein is used by antibodies to recognize and bind to the virus particle and neutralize it, same as with poliovirus. But let's imagine, as happens to be the case, that the virus is highly error prone in replicating its genome. When I say error prone, I mean that instead of the host cell, polymerase, which makes ultimately one mistake out of a billion, the viral replication machinery makes mistakes all the time. It's quite defective in the fidelity and the faithfulness with which it replicates nucleic acid.

That means that after each cycle of replication, there are in effect mutant viruses that have been produced, mutant progeny viruses, and where the mutation rate instead of being one in 10-9 might be one in 10-2 or one in 10-3. And that means that there are continually novel variants of HIV being produced in a person's body.

Let's imagine that that person has developed antibodies against the viral glycoprotein of the virus that initially infected him or her.

Let's imagine that. And those antibodies are successful in eliminating most of the virus particles of the sort that initially infected that individual. But now we can imagine the possibility that in the imperative weeks or months, a new strain of HIV will arise within that individual's body a mutant strain in which the sequences that code the viral glycoprotein had been changed slightly. And now, the viral glycoprotein has changed slightly its epitopes. And the initially developed neutralizing antibody that recognized the initial cohort of virus coming into the cell in the individual no longer works because the virus has undertaken a strategy of immune evasion, sometimes it's called immunoevasion, in which now the viral glycoprotein, although it's still competent to affect a replication cycle to adsorb and fuse to the surface of an affected cell.

Many of the epitopes, many of the oligopeptide antigens on the surface of the glycoprotein have been changed slightly through amino acid substitutions, through point mutations.

And hence, the initially developed antibody, which previously was successful in glomming on and neutralizing this virus particle is rendered ineffective. And now, this second wave, this new strain of HIV will grow up and expand in that individual, and once again provoke a new immune response.

And, the same cycle will repeat it. The second strain will now soon be eliminated, but while the elimination is going on, there's strong Darwinian selective pressure favoring the outgrowth of yet another mutant strain which is not recognized by either of the two initial antibody responses. And so, over this period of many years, what's happening is that the virus in the immune system are playing continual cat and mouse games with one another.

The immune system goes after the virus the virus moves over here the immune system goes after that and so you have a succession of antigenic variance. Here's one variant.

Here's another variant. Here's another variant, and so forth. By the time the immune system succeeds in getting rid of the first variant, a new variant has appeared, and then the immune system ramps up its defenses and tries to get rid of that. And, it succeeds almost. But by the time that has happened, yet a third variant has appeared. And so, there are these continual clonal successions. A clonal succession represents a time where one clonal virus explodes, expands. It's soon eliminated, collapses, and then another clone comes up and expands.

And this goes on. This works OK for about four, five, six years. But ultimately, the ability of the T helper cells to replenish themselves and to continue to mount an effective immune response fails.

There's yet another aspect of HIV infection which is so insidious, and that's the following. Let's look at the viral life cycle right here, and the provirus, remember the provirus is this thing right here, which is integrated into the chromosomal DNA.

And, we can assume that this provirus is transcribed by RNA polymerase too, and I will tell you that the promoter of the provirus is carried in by the proviral DNA, and actually depends on transcription factors that are present in the T helper cell. In fact, you'll recall that the T helper cell gets excited sometimes, and other times it's not excited.

And she gets excited if I can attach gender to a T helper cell, when she encounters macrophages and dendritic cells, and/or when she encounters B cells. Other times, the T helper cell is kind of quiet and unactivated (sic). And, what happens when a T helper cell gets activated through these encounters?

The T helper cell starts making her own transcription factors, which are used in order to facilitate these complex biological interactions with both antigen-presenting cells, macrophages and dendritic cells, and later on, B cells. And those same transcription factors that the T helper cell uses to turn on its own expression program are used by the provirus to transcribe its own DNA, i.e. HIV has evolved a proviral promoter sequence here which takes advantage of transcription factors that are present uniquely in an activated T cell.

And when those transcription factors are available, not only does the T cell become activated, but the provirus becomes transcribed because these transcription factors now enable RNA polymerase 2 of the host to transcribe the provirus.

But let's imagine now, if we follow that scenario to its conclusion, what happens when the T cell is not activated?

When the T cell is quiescent, when it's quiet, these transcription factors are unavailable to attach to the promoter of the integrated provirus, and as a consequence the provirus will not be transcribed.

It won't make RNA, and in that situation, how will anybody know that there's an integrated provirus in there? Well, the provirus is not being transcribed. The transcripts aren't being used to make viral protein. So in effect, the only evidence for the existence of HIV in the cell is this segment of DNA.

In other words, this provirus can hide out in an unactivated quiescent T cell indefinitely. And, the immune system can't know that there's a provirus hiding out in this T helper cell because it's not being transcribed. And therefore, one can have a quiescent T helper cell, and several other cell types in the body, macrophages also, which aren't transcribing their proviruses. Well, you'll say, so what? It doesn't make any difference. If it's not being transcribed, it's not going to hurt the individual.

But, keep in mind that the idea of getting rid of a viral infection is to eliminate all traces of a viral genome from an infected individual, and that's what happens with smallpox and with poliovirus, and with measles and virtually all the other infections we have.

But here, we have a situation where the viral genome can hide out in a latent or inapparent (sic) configuration.

There's no way to know it's there, and it may reemerge days, weeks, months, even years later because this previously transcriptionally silent provirus may suddenly be present in a cell which suddenly becomes activated. And now, an individual who "thought" quote unquote that he or she had gotten rid of HIV infection all of a sudden realizes there are viral genomes still hiding out in the body. And what that means is that in effect, it's absolutely impossible to rid the body of HIV infection ever. Once an individual is infected, in fact, that individual is infected for life. There's no way on Earth what we have at present of getting rid of the viral infection because the viral genome is always hiding out here or there in different interstices of the immune system, hiding out in transcriptionally silent state. Of course, we have very effective drugs against HIV now. Some drugs inhibit the reverse transcriptase. Others inhibit the processing of the capsid proteins, that is, the proteins which these capsid proteins happen to be cleaved from a large, high molecular-weight protein precursor into individual proteins, and there's an inhibitor of the protease that cleaves these proteins to the mature size.

And, those drugs together hold the viral infection at bay for maybe 10, 15, 20 years. But keep in mind that even though the viral infection is being stopped by these drugs, first of all, the virus is always hiding out in the bodies of such individuals in this latent, hidden form, and secondly, there may be a slow depletion of their T helper cells in spite of the effectiveness of these drugs. On that cheerful note, I wish you a good day.


DNA Electrophoresis: Methods and Protocols

In DNA Electrophoresis: Methods and Protocols, expert researchers in the field detail many of the methods which are now commonly used to study DNA using electrophoresis as the major approach. A powerful tool that allows separating DNA molecules according to their size and shape, this volume includes methods and techniques such as 2-dimentional gel electrophoresis as the major approach. These include methods and techniques such as 2-dimentional gel electrophoresis, DNA electrophoresis under conditions in which DNA molecules are completely or partially denatured during the runs, Pulse Field Gel Electrophoresis, electrophoresis coupled to fluorescence in situ hybridization, as well as protein-DNA interactions studied using electrophoreses. Written in the highly successful Methods in Molecular Biology series format, chapters include introductions to their respective topics, lists of the necessary materials and reagents, step-by-step, readily reproducible laboratory protocols, and key tips on troubleshooting and avoiding known pitfalls.

Authoritative and practical, DNA Electrophoresis: Methods and Protocols aids scientists in continuing to study DNA dynamics both in live cells and in test tubes.


MATERIALS AND METHODS

Cell culture, media, siRNAs and antibodies

Human HEK293 cells were cultured in DMEM supplemented with 10% fetal calf serum at 37 o C, 5% CO2. TDRD3 Smart-Pool siRNA oligos were purchased from Dharmacon. FMR1 siRNA oligos were purchased from Santa Cruz Biotech. Transfections of plasmids and siRNAs were carried out with Lipofectamine 2000 and Lipofectamine RNAiMAX (Invitrogen), respectively, according to the manufacturer's protocols. Chicken DT40 cells were cultured at 39.5°C, 5% CO2 in RPMI 1640 medium supplemented with 10% fetal calf serum, 1% chicken serum, 10 mM HEPES and 1% penicillin/streptomycin mixture. Transfection was carried out by electroporation using the Amaxa Nucleofector2 in Solution T. For selection of stable clones, growth medium containing G418 (2 mg/ml), puromycin (0.5 μg/ml) or zeocin (0.5 mg/ml) was used. Drosophila melanogaster Schneider line-2 (S2) cells were grown in 10 cm dish in Schneider's Drosophila medium (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin (Invitrogen) at 25°C inside a normal atmosphere incubator. Saccharomyces cerevisiae strain (MATa ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3, 112 can1-100 Top3-V5::TRP1) was kindly provided by Dr. S. Brill ( 9). It was grown in YPD medium in an incubator shaker at 28°C and 200 rpm. E. coli strains expressing SPA-tagged Top1 (SPA-TopA) and Top3 (SPA-TopB) were kindly provided by Dr. A. Emili ( 10). They were grown in an incubator shaker at 37°C and 250 rpm.

The anti-RSP-6 antibody was purchased from Cell Signaling Technology (2317s). The Drosophila anti-Top3β antibody was previously described ( 11). A Drosophila anti-FMRP antibody was purchased from Abcam (ab10299). A human anti-FMRP monoclonal antibody was purchased from Millipore (MAB 2160), and a rabbit anti-cytoskeletal actin antibody (A300-491A) was from Bethyl. Drosophila TDRD3 and Top3β polyclonal antibodies were raised in rabbit against MBP-fused proteins (New England Biolabs) containing a region of TDRD3 (residues 266–323) and Top3β (residues 86–208). The antibodies were affinity-purified using the corresponding immunogen as the affinity matrix. An anti-EcoTop1 monoclonal antibody was generated as described ( 12). An anti-EcoTop3 polyclonal antibody was a kind gift from Dr. K. Marians ( 13).

Generation of chicken DT40 knockout cells

Chicken TDRD3-knockout constructs were generated as previously described ( 14) using MultiSite Gateway Three-Flagment Vector Construction Kit. The 5′ and 3′ arms were amplified from genomic DNA using the primers GGGGACAACTTTGTATAGAAAAGTTG GTAATGGCTAAAGCCAGACCTCATTC/GGGG ACTGCTTTTTTGTACAAACTTGCACCATGAAGCAAACGCACTAC and GGGGACAGCTTTCTTGTACAAAGTGGCGTAAAGCATAACATGTTGGCTGTGAAC/GGGGACAACTTTGTATAATAAAGT TGATATCCACCCAGTAACATTCATTCATCAATG, respectively. These arms were cloned into pDONR P4-P1R and pDONR P2R-P3 vectors, respectively. The knockout constructs were generated by LR recombination of pDONR-5′ arm, pDONR-3′ arm and resistant gene cassettes-contained pDONR-211. The knockout constructs were linearized by digestion with EcoRV restriction enzyme before transfection into DT40 cells. The primers GAAGGTTGTCAATCCATGGAACTGGAG/GCCTTGCTAAGTCTGACTCAGCAGACAG were used for genomic DNA PCR to identify knockout clones.

Generation of Drosophila Tdrd3-knockout S2 cells

Drosophila tdrd3 CRISPR targeting S2 stable cell lines were generated as described by Bassett et al. and O'Connor-Giles ( 15, 16). To summarize, forward (TTCGGAGAGACCACCGCGAGAGCG) and reverse (AACCGCTCTCGCGGTGGTCTCTCC) primers were selected from the CRISPR optimal target finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Two phosphorylated oligos (10 μM) in a mixture containing NEB T4 ligation buffer were heated to 95°C and the annealing process occurred after gradually cooling the mixture to 25°C. The pAc-sgRNA-Cas9 vector was obtained from Addgene (plasmid # 49330) and digested with BspQ1. The linearized vector was ligated using the annealed oligo insert and transformed into GC10 competent cells (Sigma). Sequencing confirmed the correct inserts.

For transfection, 2 μg of CRISPR plasmid was transfected in 2 × 10 6 of S2 cells cultured in Schneider's medium (Gibco) with 10% fetal bovine serum (FBS) at 25°C using Fugene HD transfection reagent (Promega). Transfections were performed in six-well plate. After 3 days, puromycin was added to final concentration of 5 μg/ml, and cells were transferred to 10 cm dish. After 4 days, cells were transferred to four 96-well plates at different dilutions. Once the cells reached confluency, they were collected, and the genomic DNAs were amplified using primers (GATAATAGTATGCACCGTCAGCCGA) and (AGATTCAGTTGGGGAACTGGCT), followed by sequencing. Western blotting was used to screen the absence of TDRD3 protein in the knockout cells.

Expression and purification of recombinant topoisomerases from different species

Recombinant EcoTop1 wildtype and mutant proteins were expressed and purified as described ( 17). Recombinant Mycobacterium topoisomerases were expressed and purified as described ( 18). NeqTop3 and its mutant were expressed and purified as described ( 19). TmaTop1 was expressed and purified as described ( 20). SsoTop3 was purified as described ( 21). His-tagged Yeast Top3 and Top3-Rmi1 complex were expressed and purified as described before ( 22). MBP-Top3 and MBP-top3-Y356F were also expressed and purified similarly, except that amylose resin was used at the affinity purification step instead of Ni-NTA resin. A recombinant reverse gyrase from S. solfataricus was expressed and purified as described ( 23, 24). A recombinant reverse gyrase from N. equitans was expressed and purified as described ( 25, 26).

Expression and purification of human Top1 and Top1mt from Baculovirus-infected insect cells were performed as previously described ( 27). Briefly, His-tagged Top1 or Top1mt expression vector was packaged into Baculovirus. Then, Sf9 cells (1 liter) were infected with an MOI (Multiplicity of infection) of 3, incubated at 27°C and harvested at 48 h post-infection. The cell pellet from Baculovirus-infected insect cells was re-suspended with 10 volumes of extraction buffer (final concentration of 20 mM HEPES, pH 7.3, 300 mM NaCl, 5 mM MgCl2, 5% glycerol, 2 mM β-mecaptoethanol, 80 mM imidazole) and complete protease inhibitors as per the manufacturer's instructions (Roche) per gram wet weight. The sample was sonicated to lyse the cells, clarified by centrifugation at 111 000 × g for 50 min, filtered (0.45 μm) and applied to a 5 ml His-Trap column (GE Healthcare) equilibrated with extraction buffer. The column was washed with extraction buffer to baseline, and proteins were eluted over a 20 column volume gradient with extraction buffer at 1 M NaCl and 1 M imidazole. Samples were dialyzed twice for at least 4 h at 4°C against at least 20 sample volumes of final buffer using 10K MWCO Snakeskin (Pierce) dialysis membrane or Slide-A-Lyzer (Pierce) cassettes.

The recombinant Variola DNA topoisomerase was expressed in E. coli strain BLR (DE3) containing plasmid pET21a(+)-vTop. The E. coli was grown in LB in the presence of 50 μg/ml of ampicillin. When OD600 reached ∼0.5, the expression of Variola DNA topoisomerase was induced by adding 1 mM of IPTG. The recombinant Variola DNA topoisomerase was purified by an SP-Sepharose FF column and followed by a Nickel affinity column.

HumTop1 and HumTop2α were purchased from TopoGEN Inc. Two different sources of humTop1 showed results that are indistinguishable.

Cloning and expression of humTop3β variants

For generating CTD-deletion mutant of humTop3β (ΔCTD), the whole N-terminal sequence was PCR amplified from pcDNA-His-Flag-humTop3β using forward primer, AAA AAGCTT gCCACCATggACTACAAggACgACgATgACAagATGAAGACTGTGCTCATGGTTG (HindIII restriction site is underlined, Kozak sequence is underlined and bold letters, and flag sequence is in bold letters), reverse primer AAA GAATTC TCAGCGTGAGAGGGGCTTGCC (EcoR1 restriction site is underlined), and AccuPrime™PfxSuperMix polymerase (Invitrogen) as per manufacturer's protocol. The product was cloned into pCDNA3 vector between HindIII and EcoR1 restriction sites.

Flag-tagged human Top3β and its mutant were expressed and purified as described previously ( 4). Briefly, HEK 293 cells were transfected with pcDNA constructs of human Top3β and its mutant using polyethylenimine (PEI). Cells were incubated in CO2 incubator shaker at 130 rpm, 5% CO2 for 72 h. Cells were then harvested, washed 2 times with cold PBS, and lysed in 3.5 volume of lysis buffer containing 20 mM Tris pH 7.5, 500 mM NaCl, 10% glycerol, 0.5% NP40, 10 mM NaF and protease cocktail (Roche) on ice for 30 min. Two volumes of cold 20 mM Tris pH 7.5 was added to the cell lysate, and the diluted lysate was centrifuged at 18 000 rpm at 4°C for 30 min. The supernatant was incubated with the anti-Flag M2-agarose beads (Sigma) at 4°C for 3 h. Beads were washed three times with cold washing buffer (50 mM Tris pH 7.5, 500 mM NaCl, 10% glycerol, 0.5% NP40, 1% EDTA and protease inhibitor cocktail), and once with cold elution buffer (25 mM Tris pH 7.5, 100 mM NaCl and 10% glycerol) for 5–8 min per wash. Flag-tagged proteins were eluted from anti-Flag M2 agarose beads in elution buffer with 200 μg/ml 3× Flag peptide (Sigma).

RNA topoisomerase assay

The circular RNA substrate was generated and purified as described ( 4). Briefly, two oligos, K128f and K128r were annealed and the double stranded product was used as a template for transcription of 128 bases long single stranded RNA (GGGAGAUUUUUUUUUU UUUUUUUUUUGUCAGACGGAUCUUUUUUUU UUUUUUUUUUUUUCUCCCGACUGGUUUUUUUUUUUUUUUUUUUUGAUCCGUCUGACUUUUUUUUUUUUUUUUUU UUCCAGUC). Transcription was performed using MEGAshortscript™ T7 kit (Ambion) as per manufacturer's protocol. RNA was purified from 6% TBE urea gel (Invitrogen) after 45 min electrophoresis at 180 V. Purified RNA was labeled with (γ 32 ) ATP (PerkinElmer) using KinaseMax kit (Ambion) following the manufacturer's protocol.

For generation of circular RNA, 4 μM of the above 32 P labeled RNA was annealed with 20 μM DNA oligo K128link ( 4) in a buffer containing 10 mM Tris pH 7.5, 100 mM NaCl in a 15 μl reaction mixture for 2–3 h. T4 RNA ligase (Ambion) was added to the annealed product and incubated for 3 h at 37°C in a 20 μl reaction mixture. DNA was removed by treating the reaction with 4 units TURBO DNase (Ambion) for 15 min at 37°C. The circular RNA substrate was purified from 15% TBE–urea gel (Invitrogen) after 11–12 h electrophoresis at 150 V.

The stand passage reaction was set up as described ( 4). Briefly, 1 nM or 3000 cpm of RNA circle was incubated with indicated protein concentrations in a 10 μl reaction mixture containing 10 mM Tris pH 7.5, 5 mM MgCl2, 2 mM DTT, 0.1 mg/ml BSA, 5% glycerol, 10% PEG400 and 4 units RNaseOut (Invitrogen) at 37°C for 90 min. The reaction was terminated using 2 μl 5× stop buffer (1% SDS, 100 mM EDTA and 1 mg/ml proteinase K (Ambion). The resulting substrates were resolved on 15% TBE–urea gel after 6 h electrophoresis at 150 V and analyzed by Storm 860 molecular imager (Molecular Dynamics). RNA topoisomerase assay reaction for TmaTop1 and NeqTop3 was incubated at 50°C. In RNA topoisomerase reaction using reverse gyrase proteins, 1 mM ATP was also included into the reaction buffer. Phenol:choloroform:isoamylalcohol was used to stop the reaction and distinguish the RNA knot from the RNA-protein complex which produces a gel-shift with distinct mobility compared to the RNA knot. It should be mentioned that we cannot convert more than 33% of the circles to knots in our assay. There are at least two possible explanations. First, the topoisomerase can convert not only a circle to a knot, but also a knot to a circle ( 3). Because the topoisomerase assay used here is a reversible reaction, the extent of the reaction is determined by not only the forward reaction rate, but also the reverse reaction rate. When large amounts of circles are converted to knots, the reverse reaction rate may become larger than the forward reaction, until the reaction reaches an equilibrium. Second, only about 33% the circular substrates may be folded correctly to allow knot formation, whereas the other substrates may be folded into conformations that prevent knot formation.

Polyribosome assay

The polyribosome assay for human HEK293 cells was done as described ( 4). The assay for Drosophila S2 Cells, chicken DT40 cells, and bacteria topoisomerases were performed as described ( 28–30).

Generation of phylogenetic tree

The phylogenetic trees for Top3β, TDRD3 and FMRP were generated using the pSI-BLAST tool from the NCBI website:

(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). Top3β and TDRD3 were only detected in eukarya by the BLAST search, and their trees were built using only search data from eukarya. FMRP was detected only in animals by BLAST search, and its tree was built using search data only from animals.


Heat-induced deamination of cytosine residues in deoxyribonucleic acid

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

Note: In lieu of an abstract, this is the article's first page.


Results

The enhancer is required for integration of infecting Mu DNA

The importance of E for transposition has been demonstrated using mini-Mu plasmids, but has not been critically tested for the whole phage genome because the E and O functions are inseparable. To determine whether E is required for integration of infecting Mu, we exploited the transposase of the Mu-related phage D108 (D108 A). Mu and D108 phages differ mainly in their operator/enhancer (O/E) region. They also differ in their Rep proteins (product of c gene Fig. 1A) and in the Iα domain of their transposases which bind O/E (Fig. 2A) (Toussaint et al., 1983 Mizuuchi et al., 1986 Jiang et al., 1999 ). The importance of O/E for lytic growth has been demonstrated by isolation of hybrids between Mu and D108, which formed plaques only if the Iα region of the transposase matched its cognate E (Toussaint et al., 1983 ). The hybrid phages had retained the O-binding Rep and Ner proteins as well, so both O and E functions were contributing to growth of the hybrids. To determine if the E function alone was required for integration of infecting Mu, integration-defective phage carrying an amber mutation in the transposase gene A (Aam1093) (O'Day et al., 1978 ), were used to infect a sup − host, complemented for integration by either MuA or D108 A supplied from a plasmid. Thus, the infecting phage have their cognate Rep(O) function, but are being queried with regard to A(E) function by providing A proteins that differ only in the E-binding Iα domains. The functionality of D108 A expressed from a plasmid was ascertained by complementation of a D108 A − lysogen for prophage induction and lytic growth only when D108 A, and not MuA, was provided (Fig. S2). If the E function is dispensable for Mu integration, as it is during enhancer-independent transposition reaction conditions in vitro (Chaconas and Harshey, 2002 ), we would expect either MuA or D108 A to support integration of the A amber Mu phage, because the rest of the protein (Iβγ, catalytic domain II and regulatory domain III Fig. 2B) is similar in the two transposases and promotes catalysis using either Mu or D108 ends (Toussaint et al., 1983 ) if the E function is not dispensable, integration should be MuA-specific. The results are shown in Fig. 2B. At various times after infection, total cellular DNA was isolated and subjected to pulse field gel electrophoresis (PFGE) to separate chromosomally integrated Mu from free Mu DNA the isolated chromosomal DNA was tested for Mu integration by PCR, using Mu-specific primers (Au et al., 2006 ). When the complementing transposase was MuA, the Mu Aam phage integrated into the host chromosome with kinetics similar to that observed for wild-type phage, where the Mu integration signal is normally detected within 15 min after infection, and increases thereafter due to Mu replication (see Fig. 3A top panel and Fig. 6 Choi and Harshey, 2010 ). When the complementing transposase was D108 A, however, Mu integration was not detected. We conclude that the E function, i.e. transpososome assembly function, is essential for integration of infecting Mu.

O/E binding specificities of Mu and D108 transposase A proteins, and requirement for E during Mu integration.

A. Domain organization deduced for the transposase MuA, extrapolated to D108 A. Three major domains mapped by partial proteolysis (Nakayama et al., 1987 ), have been assigned DNA binding, Catalysis and Allosteric control functions (Chaconas and Harshey, 2002 ). Domain Iα binds three sites (O1–O3) in E, and Iβγ binds three sites within L and R (see Fig. 1A). DDE are the catalytic residues for transposition (Montano and Rice, 2011 ). Domain III has overlapping recognition sites for two regulatory proteins, ClpX and MuB (Levchenko et al., 1997 ). MuA and D108 A proteins differ mainly in their E binding Iα domains. See text.

B. Integration of MuAam phage in a sup − host (BU40) at various times after infection, complemented by plasmids in the host strain expressing either wild-type MuA or D108 A from pWY12 and pWY15, respectively, with the level of transposase expression that is attained in the absence of inducer IPTG (see Fig. S2). Genomic DNA was isolated as described in Experimental procedures, and Mu integration was detected by primers specific to Mu. N, no template control M, input Mu C, control genomic DNA isolated after PFGE by mixing with free Mu DNA prior to electrophoresis in order to gauge the extent of contamination of the genomic DNA with free Mu DNA (Au et al., 2006 ).

Role of regulatory proteins Rep and Ner in FD removal.

A. Kinetics of detection of integrated Mu and FD (lacZ) sequences at two temperatures that inactivate the ts Rep. FDs were amplified across the Mu R end – lacZ junction as described in Experimental procedures. Other descriptions as in Fig. 2B.

B. Strain BU1384 carrying three different plasmids was infected with ner − phage (from CW54) at 37°C, with or without the indicated plasmid. pWY62 expresses Ner, A, and B from the natural promoter Pe. pIL137 expresses A and B from Ptet, but uninduced expression levels were sufficient to support Mu integration. Ner expression in pWY59 was induced with 0.1% arabinose for this plasmid. Other descriptions are as Fig. 2B.

Ner, but not Rep, is required for flanking DNA removal

Upon Mu infection, the FD signal is detected concomitantly with detection of integrated Mu, but diminishes significantly by 30 min when Mu is actively replicating, and is typically undetectable thereafter (Au et al., 2006 Choi and Harshey, 2010 ). Since FD removal is seen only after integration (strand transfer), it is possible that the configuration of the strand transfer transpososome must play a role in controlling the timing of degradation. Given that the enhancer remains associated with the strand transfer transpososome in vitro (Pathania et al., 2003 ), we wished to test if this association was important for FD removal, in which case proteins that bind O/E might influence this process (Fig. 1A and B). We therefore monitored the effects of inactivating Rep and Ner proteins in the FD removal assay as described below. An earlier study had shown that IHF activity was not important, since Mu infection in an IHF mutant strain showed normal FD removal kinetics (Au et al., 2006 ).

The methodology for detecting FD after integration of infecting Mu has been described (Au et al., 2006 Choi and Harshey, 2010 ). Briefly, lacZ sequences are used as FD markers. These sequences are enriched in progeny phage derived from induction of a Mu prophage integrated in lacZ. When a lac − host is infected with these phage, lacZ FD linked to integrated Mu is readily detected by PCR. The FD at both Mu ends is degraded (Au et al., 2006 ), so either end can be monitored for its presence.

To test the role of Rep in FD removal, phage carrying the temperature-sensitive Rep allele, cts62, were used for infection. This Rep variant has reduced DNA-binding to O at all temperatures compared to the wild-type Rep, but the binding defect is most exacerbated at higher temperatures (Vogel et al., 1991 ). If Rep played a role in FD removal, we would expect to see differences in FD removal kinetics at higher temperatures. As observed earlier, both Mu and lacZ FD sequences were detected within 15 min of infection (Fig. 3A, compare left and right panels). While the Mu signal continued to increase during the time-course monitored, the FD signal was maximal at 15 min, decreased by 30 min, and was undetectable by 50 min. Although the infected cultures lysed faster at 42°C, than at 37°C (Fig. S3A), the Mu and FD profiles were similar at the two temperatures. Thus, the inability of Rep to associate stably with DNA does not affect FD removal.

To assess the effect of Ner on FD removal, ner − phage were prepared as described in Experimental procedures Ner is required for lytic growth. Infection with these phage resulted in normal integration, even in the absence of Ner in the host (Fig. 3B top ‘no vector’ panel, Mu), but the cells did not enter lytic growth (Fig. S3B), allowing observation of the FD for longer times. Interestingly, the FD signal persisted until the last time point examined (90 min Fig. 3B, top panel, FD). To test if complementation with Ner would restore FD removal in ner − infections, Ner was provided in the recipient host. Different plasmids were tested as the source of Ner because induction of ner − prophage had been observed to be sensitive to Ner levels (see Experimental procedures). When ner, A and B were expressed from the natural Pe promoter (pWY62), FD was processed normally (Fig. 3B, second panel), and infected cells went through lytic growth (Fig. S3B). To separate the contributing effects of Ner from that of A and B proteins, FD removal in the ner − Mu integrants was tested under three other conditions. When only A and B were provided, i.e. no Ner (pIL137), the FD remained attached (Fig. 3B, third panel). When Ner alone was provided from the arabinose-inducible pBAD promoter (pWY59), FD removal depended on the induction level of Ner. In the absence of inducer, where there is leaky expression from this promoter (Guzman et al., 1995 ), a wild-type pattern of FD processing was observed (Fig. 3B, fourth panel) this level of Ner was not sufficient to promote lytic growth (Fig. S3B). Thus FD removal is not dependent on lytic growth. When Ner synthesis was induced with 0.1% arabinose, FD removal was inhibited (Fig. 3B, bottom panel). High levels of Ner are known to shut off Pe as expected, cells did not progress through the lytic cycle (Fig. S3B) (Van Leerdam et al., 1982 Goosen and van de Putte, 1987 ). The absolute levels of Ner under all these conditions proved problematic to monitor. We therefore used Pc transcript levels as an indicator of Ner levels (Fig. S3C). The data were consistent with the known inhibitory effect of Ner on Pc transcription.

In summary, of the two transcription regulators Rep and Ner that function at O, Ner appears to play a role in the post-integration removal of the DNA flanking Mu ends. FD removal is sensitive to Ner levels, and is observed only when Ner levels are low FD is not removed in the absence of Ner or when Ner levels are high.

Ner influences flanking DNA removal by modulating Pc transcription

Absence of Ner is expected to favour Pc transcription, generating Rep, which will bind O and block not only Pe transcription, but also E function (Fig. 1A) (Mizuuchi and Mizuuchi, 1989 ). However, the infection experiments are carried out at high temperature where Rep is non-functional, so a Rep effect can be ruled out. Transcription from Pc per se, i.e. in the absence of functional Rep, was reported to inhibit lytic growth in a ner mutant this inhibition was relieved by deletion of Pc (Goosen and van de Putte, 1986 ). These data led us to test whether the effect of Ner on FD removal was related to Pc transcription. To do so, we constructed a prophage that inactivated both Pc and ner as described under Experimental procedures. The ΔPc Δner phage integrated as efficiently as the Δner phage under these conditions (Fig. 4, compare the Mu signal in the first and second panels), but went through lytic growth (Fig. S4 Goosen and van de Putte, 1986 ). There was a striking difference, however, in their kinetics of FD removal. Whereas the FD signal from integrated ner − phage persisted until the last time point tested (90 min), this signal from the integrated ΔPc Δner phage showed wild-type kinetics of disappearance. Thus, the deletion of Pc alleviated the FD removal defect caused by the deletion of ner. Therefore, absence of Ner inhibits FD removal by promoting Pc transcription.

FD removal in wild-type host infected with ner phage or ΔPc ner phage. Infection conditions as in Fig. 3. The ΔPc Δner phage do not express B protein, which is essential for efficient integration (Chaconas and Harshey, 2002 ). MuB was therefore supplied in the recipient host from plasmid pIL137, which encodes both A and B no inducer was added. To provide Ner, A and B, pWY96 and pIL137 were used. The expression of Ner was induced from pWY96 with 0.1% arabinose. Other descriptions as in Fig. 2B.

A plausible explanation for why Pc transcription, but not the product of this transcription, would affect distant events at the FD is that this transcription interferes with E function by perturbing its topology within the transpososome. This would also explain why high levels of Ner, which are expected to block Pc transcription, would have the same effect (Fig. 3B, last panel). In this case, Ner binding to O would perturb E topology. The latter proposition can be tested in vitro, and is described below. The reason why similar levels of Ner did not inhibit FD removal in the ΔPc Δner phage infection (Fig. 4, last panel) might be attributed to deletion of DNA immediately adjacent to the Ner binding site between O2 and O3, which might have altered the stability of Ner on DNA (Fig. 1A, bottom panel).

Ner disrupts E–R crossings

In vitro experiments have deduced a five-noded topology of the DNA segments bound by the transpososome (Harshey and Jayaram, 2006 ). Given the high degree of correspondence between in vitro and in vivo requirements for all the cis and trans elements/factors essential for transposition (Chaconas and Harshey, 2002 ), the topology of the transpososome, which is dictated by these elements/factors, is also expected to be similar in vivo. However, an in vivo variable is transcription across E, which would be expected to modulate the DNA crossings. Of the five DNA crossings between L, E and R, one is contributed by R3–E (Fig. 1B left, black dot) (Yin et al., 2005 2007 ). Transcription from Pc, or Ner binding, could impact this crossing. The latter proposition was tested by adding Ner to the transpososome assembly reaction, and assessing the configuration of the R3–E crossing by difference topology using Cre recombinase. Two mini-Mu plasmids pSP(R)Dir and pSP(R)In, which differ only in the orientation of loxP sites flanking the R end, either direct (Dir) or inverted (In), were employed (Fig. 5). Transpososomes in which Mu ends had been cleaved (Type I reaction) were assembled, so the Cre recombination products would be naturally nicked removal of supercoils is essential for analysis of the products by gel electrophoresis (Fig. 5A and B, lane 2). Under wild-type conditions, the transpososomes will yield predominantly 4Cat and 5Knot products after Cre recombination on the Dir and In substrates, respectively, because R crosses E and L four times (Fig. 5A and B, lanes 3 see schematic in this figure and also Fig. 1B) (Pathania et al., 2002 ) the extra crossing in the In substrate comes from the need to align loxP sites in an antiparallel configuration for recombination (Guo et al., 1997 Kilbride et al., 1999 Grainge et al., 2002 ). If Ner were to disrupt only the distal E–R crossing, Cre recombination would yield 4-Cat and 3-Knot products if both E–R crossings were disrupted, Cre would give 2-Cat and 3-Knot products. The results show that addition of Ner gave 2-Cat and 3-Knot products (Fig. 5A and B, lanes 4 and 5), suggesting that Ner disrupted both E–R crossings, leaving the two L–R crossings intact. Ner altered the E–R topology only if it was included in the reaction from the start, and not if added after transpososome assembly. We conclude that Ner directly influences the integrity of the E–R crossings.

Effect of Ner on the E–R DNA crossings in an assembled MuA synapse. A and B (left panels) show products of Cre recombination on supercoiled pSP(R) Dir and In substrates, respectively, after assembling a Type I (cleaved) transpososome with MuA and HU proteins as described in Experimental procedures, in the presence or absence of Ner (lanes 4, 5, 6: 56, 28, 14 μg ml −1 Ner). Reactions were deproteinized before electrophoresis, as described in Experimental procedures. OC, open circular SC, supercoiled. The numbers on the right indicate catenane or knot nodes in the Dir and In substrates respectively these are derived from the known position of these bands characterized previously (Pathania et al., 2002 Yin et al., 2005 ). The band below the SC position on the Dir substrate is the larger of two deletion circles generated from the free plasmid (i.e. not converted to Type I) after Cre recombination. The right panels show a self-explanatory schematic tracking catenane and knot product formation after Cre recombination on an assembled Mu synapse.

FD removal is blocked in phages carrying deletion of R3 and L3 sites. Infection, DNA isolation and PCR assays were as described in Figs 3 and 4, except that the FD sequence monitored was malF, because the original prophage was located in this gene in strain MP1999. The ΔR3 strain lyses slowly (Fig. S5), so FD removal could be monitored for a longer time in this strain.

Deletion of R3 or L3, which disrupt crossings with E, also block removal of flanking DNA

The results in Figs 3-5 suggest that E–R interactions play a critical role in FD removal. To test this directly, we deleted the R3 site on the Mu genome. This site is the most distal of the three MuA binding sites at the R ends (Fig. 1A). As a control, we separately deleted the most distal site L3 at the L end R3 and L3 sites cannot be simultaneously deleted (Allison and Chaconas, 1992 ). The lysis profiles of prophages carrying these single site deletions are shown in Fig. S5. Lysis was slightly delayed in the ΔL3 Mu, but substantially delayed in the ΔR3 strain however, phage titres from these strains were comparable to wild-type. Phage isolated from both deletion strains were used in infection experiments to monitor FD removal. Compared to wild-type, both ΔL3 and ΔR3 phages integrated normally (Fig. 6, Mu panels), but neither degraded their FD (Fig. 6, FD panels). The ΔR3 phage was followed for a longer time because lysis is delayed in this mutant (Fig. S5).

The similar effect of deleting either R3 or L3 on FD removal could stem from the destabilization of E within the transpososome. Although these deletions would disrupt one of three crossings E makes with the L and R ends (Fig. 1B), all three may be needed to anchor E within the transpososome in the face of transcriptional activity at O. This scenario is also applicable to the Ner results (Figs 3-5). Loss of even one E crossing by the R3 or L3 deletion might alter the disposition of the other non-catalytic MuA subunit. Our data suggest that these subunits play an important role in events that lead to FD degradation.


INTRODUCTION

Cytokinesis partitions the cytoplasm of the dividing cell, which requires targeting of membrane vesicles to the plane of division. In yeast and animal cells, a contractile actomyosin ring supports ingrowth of the existing plasma membrane, and this cleavage furrow is expanded by the fusion of membrane vesicles that are delivered along furrow microtubule arrays (reviewed by Robinson and Spudich, 2000EF43Straight and Field, 2000EF56). By contrast, plant cells form the partitioning plasma membrane de novo from the centre to the periphery of the cell (reviewed by Staehelin and Hepler,1996EF54 Heese et al.,1998EF21). Golgi-derived vesicles are transported along the microtubules of a plant-specific cytoskeletal array,the phragmoplast, to the plane of cell division where they fuse with one another to form a transient membrane-bounded compartment, the cell plate,which matures into a cell wall with flanking plasma membranes. The lateral expansion of the cell plate is mediated by the transformation of the phragmoplast from a compact array into a widening hollow cylindrical structure that delivers additional vesicles to the growing edge of the cell plate until the latter fuses with the parental plasma membrane (Samuels et al.,1995EF47). Thus, plant cytokinesis is a special case of vesicle trafficking and fusion.

Mutations in several genes of Arabidopsis, including KNOLLE and KEULE, result in cytokinesis defects, such as enlarged cells with incomplete cell walls and more than one nucleus (Lukowitz et al., 1996EF33 Assaad et al.,1996EF1 Nacry et al.,2000EF38). KNOLLE encodes a cytokinesis-specific syntaxin (Lukowitz et al.,1996EF33 Lauber et al.,1997EF31). KEULE is a member of the Sec1 family of syntaxin-binding proteins that interacts with KNOLLE in vitro and in vivo, and mutations in both genes result in the accumulation of unfused cytokinetic vesicles (Assaad et al.,2000EF2 Lauber et al.,1997EF31 Waizenegger et al.,2000EF61). Whereas the KEULE gene appears to be expressed in both proliferating and non-proliferating cells (Assaad et al.,2000EF2), the expression of KNOLLE is tightly regulated during the cell cycle. KNOLLEmRNA accumulates transiently in proliferating cells, giving a patchy pattern that reflects asynchrony of cell division in the embryo (Lukowitz et al.,1996EF33). KNOLLE protein accumulates only during M phase, initially in patches presumed to represent Golgi stacks, then localises to the forming cell plate during telophase and disappears at the end of cytokinesis (Lauber et al.,1997EF31). The tight regulation of KNOLLE expression is reminiscent of the synthesis and degradation of mitotic cyclins (Ito, 2000EF24). KNOLLE syntaxin appears to be involved in all sporophytic cell divisions as well as in endosperm cellularisation (Lauber et al.,1997EF31).

Syntaxins are components of SNARE complexes that play an important role in membrane fusion events (reviewed by Jahn and Südhof,1999EF27). The SNARE core complex consists of three or four proteins that form a four-helix bundle: a bipartite t-SNARE on the target membrane, which consists of a syntaxin and a SNAP25 protein or two t-SNARE light-chain proteins, interacts with the v-SNARE synaptobrevin on the vesicle membrane (Clague and Herrmann,2000EF10). There are numerous members of each SNARE protein family in yeast, animals and plants that have been implicated in diverse vesicle trafficking pathways between membrane compartments (for reviews on plant SNAREs, see Blatt et al.,1999EF7 Sanderfoot et al.,2000EF48). In general, syntaxins and synaptobrevins involved in a particular pathway appear more closely related to functional counterparts in different organisms than to family members involved in a different pathway within the same organism. The original SNARE hypothesis postulated that specific pairs of cognate syntaxins and synaptobrevins provide specificity to vesicle trafficking(Söllner et al.,1993aEF51Söllner et al.,1993bEF52). This idea was challenged in recent in vitro interaction studies that provided evidence for promiscuity among interacting SNARE partners (Fasshauer et al.,1999EF15). However, thorough analyses of yeast SNARE interactions in liposome assays have indicated a high degree of specificity of interaction between syntaxins and synaptobrevins(Fukuda et al., 2000EF17 McNew et al., 2000EF36 Parlati et al.,2000EF42).

KNOLLE is a distant member of the plasma membrane subgroup of the syntaxin family but has no close counterpart among yeast or animal syntaxins (Lukowitz et al., 1996EF33 Sanderfoot et al., 2000EF48). However, syntaxins with analogous roles in membrane fusion during cellularisation or cytokinesis have been described in animals. The Drosophila syntaxin 1 gene is required for cellularisation of the blastoderm embryo, as well as for neural development (Burgess et al.,1997EF9). Likewise, the Caenorhabditis syn-4 gene is involved in embryo cleavage divisions but also plays a role in nuclear membrane reformation (Jantsch-Plunger and Glotzer, 1999EF28). In contrast to the other two syntaxins, KNOLLE is required only for de novo formation of the partitioning plasma membrane during cytokinesis, and its expression is tightly regulated during the cell cycle, suggesting a unique role in cytokinesis.

We have addressed the biological significance of the tight regulation of KNOLLE expression by replacing the endogenous 5′ regulatory region with promoters that are active in both proliferating and non-proliferating cells. The transgenic plants were phenotypically normal, although KNOLLE protein accumulated strongly in non-proliferating cells and was mistargeted to the plasma membrane. Conversely, the KNOLLE transgene did not rescue knolle mutant embryos, which correlated with low-level accumulation of mRNA from the KNOLLE transgene in proliferating embryonic tissue,when compared with the activity of the endogenous KNOLLE gene. Our observations suggest that the tight regulation of KNOLLE expression meets two opposing requirements. First, the KNOLLE gene must be strongly expressed to produce sufficient KNOLLE protein during M phase for the efficient execution of cytokinetic vesicle fusion. Second, degradation of KNOLLE mRNA and protein prevents the accumulation of large quantities of useless molecules.


News analysis – Basic Assembler language (BAL)

The Earth Lab human TEST activity is first … then the newspaper / magazine report …and then the TRANSLATE of the report using basic math, physics, biochemistry college textbooks, etc. Thus the newspaper prints some pieces to a puzzle .. and the reader is asked to figure out the other pieces … the pieces that explain WHY …. that explain CAUSE and EFFECT .

Herb Zinser provides some data about Nature’s SYMBOL MACHINE comprised of nouns, verbs, concepts, math equations, flowcharts, etc. The ideas found in math and science textbooks are part of the SYMBOL MACHINE.

Using Galileo’s suggestions of ” 2 CHIEF WORLD SYSTEMS” we now perceive Sartre existentialism as partitioned into 2 or more data spaces…….

the 2 CHIEF existential entities

1) physical reality of objects: concrete highways, iron automobiles, cellulose trees, humanoids, etc.

2) The world of symbols, concepts, process control system flowcharts, biochemistry diagrams, math and physics equations, etc.

Maps and Territories – Rijnlandmodel

Language in Thought and Action, S.I. Hayakawa.

Chapter 2 Symbols Maps and Territories There is a sense in which we all live in two worlds.

Thus we understand Charles Dickens ” TALE of 2 Cities”.

Thus we have the source domain of SYMBOL LIFE and thought that may get mapped to the destination range of physical biology with human activities on the geography surface of EARTH.

Let’s look at some news articles and TRANSLATE the embedded subset codes and concepts.
Thanks to Isaac Asimov …..

Foundation series – Wikipedia

The Foundation series is a science THEORY .. thought implants of mathematical power series …. VIA a series of books by Isaac Asimov. For nearly thirty years, the series was a trilogy: Foundation, Foundation and Empire, …
‎Publication history · ‎Plot · ‎Development and themes · ‎The Foundation series

Foundation series … Trantor – Wikipedia

The Foundation series is a science fiction series of books by Isaac Asimov. For nearly thirty … Prelude to Foundation opens on the planet Trantor, the empire’s capital planet, the day after Hari Seldon has given a speech at a conference.


Materials and methods

Plasmid constructions

Plasmids are listed in Supplementary file 1. Plasmids were constructed using Gibson Assembly kit (SGI cat#GA1200) unless otherwise indicated. Restriction enzymes, T4 DNA ligase, and Klenow were from New England Biolabs and used according to their protocols. Mutagenesis was carried out using QuikChange Lightning Multi kit (Agilent cat#210515) sequence changes were confirmed by DNA sequencing (Retrogen Inc). STBLII cells were used for maintenance of plasmids containing tandem repeats (Invitrogen cat#10268019). Primer sequences for plasmid constructions are given in Supplementary file 2. NUP49-GFP was PCR-amplified from pUN100-GFP*-Nup49 (from V Doye) using primers Nup49-GFP-F and Nup49-GFP-R and subcloned into XhoI+SacI digested vectors pRS403 and pRS404 (Sikorski and Hieter, 1989) to yield p403-Nup49-GFP and p404-Nup49-GFP, respectively. Primers ADE2-up-F and ADE2-int-R and separately ADE2-farup-F and ADE2-up-R were used to amplify sequences of ADE2 for targeting and as a selectable marked these were inserted into pbluescriptKS+ to create pblueKS-ADE2target. TetR-Tomato was PCR-amplified from plasmid p402-TetR-Tomato (from S Sabatinos) using primers TetR-Tom-F and TetR-Tom-R and inserted into PacI-digested pblueKS-ADE2target to generate pTetR-Tom-ADE2. 2.1kbp KpnI-SacI fragment containing LacI-GFP was subcloned from pAFS135 (from J Bachant) into pRS404 digested with same enzymes to create p404-LacI-GFP. Plasmids containing tetO (pGS004 from J Bachant) or lacO (pJBN164 from J Bachant) arrays were modified by introduction of genomic sequences to target integration near different origins. The following primer pairs were used to generate sequences adjacent to the indicated origins (with the corresponding chromosomal coordinates given in parentheses): primers ARS501-tetO-F and ARS501-tetO-R for ARS501 (V:547812–548329), primers ARS1103-tetO-F and ARS1103-tetO-R for ARS1103 (XI:54673–54996) and primers ARS1303-tetO-F and ARS1303-tetO-R for ARS1303 (XIII:31983–32247), and these were inserted into KpnI+ClaI digested pGS004 yielding pARS501-tetO, pARS1103-tetO, and pARS1303-tetO, respectively. Likewise, the following primer pairs were used to generate sequences adjacent to the indicated origins: primers ARS710-lacO-F and ARS710-lacO-R for ARS710 (VII:204305–204831), primers ARS718-lacO-F and ARS718-lacO-R for ARS718 (VII:422375–423281), and primers ARS1018-lacO-F and ARS1018-lacO-R for ARS1018 (X:539662–540395), and these were inserted into XhoI+KpnI digested pJBN164 yielding pARS710-lacO, pARS718-lacO, and pARS1018-lacO, respectively. Two adjacent regions near ARS305 were PCR-amplified using primer pair NotI-ARS305-5’ and XhoI-ARS305-5’ (III:37283–37778) and primer pair NotI-ARS305-3’ and KpnI-ARS305-3’ (III:37779–38282) and digested with NotI and XhoI and NotI and KpnI, respectively these fragments were ligated into pRS404 digested with XhoI and KpnI. The XhoI-KpnI fragment was subcloned by digestion and ligation into pJBN164 digested with same enzymes to yield pARS305-lacO. Plasmids p501Δ-ARS305-ΔACS and p501Δ-ARS305-∆2BS were created by mutagenesis of p501Δ-ARS305 (Peace et al., 2016) with primers ARS305-∆ACS-mut1, ARS305-∆ACS-mut2 and ARS305-∆2BS-mut1, and ARS305-∆2BS-mut2, respectively. Plasmid p404-ars305∆-BInc was constructed as described for p306-ars305∆-BrdU-Inc (Zhong et al., 2013) except that p404-BrdU-Inc (Viggiani and Aparicio, 2006) was used instead of p306-BrdU-Inc. p404-ars305∆-BInc was digested with PmlI and KpnI, blunted-ended with Klenow, and ligated with T4 DNA ligase to remove the TRP1 selectable marker, yielding p400-ars305∆-BInc. The 1.5 kb SalI-SpeI fragment containing the KanMx cassette from pFA6-KanMx (Longtine et al., 1998) was ligated into SalI-SpeI-digested p400-ars305∆-BInc, creating pKanMx-ars305∆-BInc. The cdc45-1 allele was PCR-amplified from strain YB298 (from B Stillman) with primers Cdc45-F and Cdc45-R and inserted into SacI+KpnI digested pRS406 (Sikorski and Hieter, 1989) to create p406-cdc45-1.

Yeast strain constructions

All strains are congenic with SSy161, derived from W303-1a (RAD5) (Viggiani and Aparicio, 2006) complete genotypes are given in Supplementary file 3. Strain constructions were carried out by genetic crosses or lithium acetate transformations with linearized plasmids or PCR products generated with hybrid oligonucleotide primers having homology to target loci (Ito et al., 2001 Longtine et al., 1998) primer sequences for strain constructions are given in Supplementary file 2. Genomic alterations were confirmed by PCR analysis or DNA sequence analysis as appropriate.

FKH1 was deleted using primers Fkh1-up and Fkh1-down to amplify KanMx selectable marker from pFA6-KanMx (Longtine et al., 1998). FKH2 was replaced by fkh2-dsm in two steps: first, FKH2 was entirely replaced with URA3 (C. albicans) using pAG61 (Addgene), and the resulting strain was transformed with fkh2-dsm DNA from p405-fkh2-dsm (Ostrow et al., 2017) followed by selection on 5-FOA. GAL-FKH1 was introduced using p405-GAL-FKH1 and FKH1 was FLAG-tagged as described previously (Peace et al., 2016). ARS501 was replaced by ARS305 or mutant versions of ARS305 by transformation with p501∆-ARS305, p501∆-ARS305-∆ACS, or p501∆-ARS305-∆2BS as described previously (Peace et al., 2016). BrdU incorporation cassette was introduced, replacing ARS305, by transformation with BglII-digested p404-ARS305-BrdUInc. The cdc28-as1 allele was introduced by pop-in/pop-out of plasmid pJUcdc28-as1 digested with HindIII. The cdc7-as3 allele was introduced as described previously (Zhong et al., 2013) cdc7-4 was back-crossed from H7C4A1 (from L Hartwell) into the W303 background four times, with the final cross to HYy151. MCM4-DD/E+DSP/Q (referred to in text as MCM4-14D) was introduced by transformation with PacI-digested pJR179 (from SP Bell). The cdc45-1 allele was introduced by crossing with strain YB298 (from B Stillman) or by pop-in/pop-out with BglII-digested p406-cdc45-1. The dbf4∆C allele was constructed by insertion of a non-sense codon with the KanMx cassette from pFA6-KanMx (Longtine et al., 1998) using primers Dbf4-up and Dbf4-down. TetR-Tomato was introduced by transformation with PacI-digested pTetR-Tom-ADE2. LacI-GFP was introduced by transformation with HindIII-digested p404-LacI-GFP. The tetO or lacO arrays were introduced by transformation with pARS501-tetO, pARS1103-tetO, pARS1303-tetO, pARS305-lacO, pARS710-lacO, pARS718-lacO and pARS1018-lacO digested with PacI, PshAI, BlpI, NotI, PshAI, SnaBI, and BlpI, respectively.

Cell growth and synchronization

Cells were grown at 25°C unless otherwise indicated. For microscopy, cells were grown in complete synthetic medium supplemented with 15 μg/mL adenine (CSM+ade) +2% dextrose, unless otherwise indicated (raffinose or galactose) for QBU and ChIP-seq, cells were grown in YEP +2% dextrose, unless otherwise indicated (raffinose or galactose). G1 arrest was achieved by incubation with 2.5 nM (1x) α–factor (Sigma T6901) for most extended arrests, a fresh or additional dose of α–factor was added at time of induction/non-induction or at time of temperature shift as indicated in figure legend. PP1 (Tocris Biosciences) was added to 25 μM at the time of initial α–factor incubation. Reagents are listed in Supplementary file 4.

Live-cell fluorescence microscopy and image analysis

5×10 6 cells were harvested by centrifugation and spread on agarose pads made of CSM+ade +4% dextrose. A DeltaVision wide-field deconvolution microscope was used to capture 28 Z-stacks in 0.25 μm increments for each image. SoftWorX software (Applied Precision/GE Healthcare) was used for deconvolution and three-dimensional reconstruction of nuclei, and for measuring the distance between replication origins and nuclear periphery. For experiments with mutant strains having irregularly shaped nuclei (e.g.: fkh1∆ fkh2-dsm), measurements were made in three-dimensions otherwise, measurements were made in two dimensions using a few middle sections as previously described (Ryu et al., 2015). A z-test was applied to compare the distribution of measured distances. Images are max intensity projections of two to four middle Z-stacks.

Quantitative BrdU Immunoprecipitation (QBU)

QBU and analysis of sequencing reads was performed as described previously using KAPA Hyper Prep Kit (KK8504) (Haye-Bertolozzi and Aparicio, 2018). Data analysis was performed using 352 replication origins classified as Fkh-activated, Fkh-repressed, or Fkh-unregulated (Knott et al., 2012) the latter two classes are grouped together as ‘other origins’ in Figure 2—figure supplement 1. Reagents are listed in Supplementary file 4.

Chromatin immunoprecipitation analyzed by sequencing (ChIP-seq)

ChIP-seq and analysis of sequencing reads was performed as described previously using KAPA Hyper Prep Kit (KK8504) (Ostrow et al., 2015). Data analysis was performed using 95 replication origins classified as Fkh-activated (Knott et al., 2012). Reagents are listed in Supplementary file 4.

Time-lapse video and MSD analysis

A DeltaVision wide-field deconvolution microscope was used to capture 20 Z-stacks in 0.30 μm increments for each time point. GFP signals were imaged every 12 s for 5 min, with 0.1 s exposure for each Z-stack and 32% of transmitted light using an LED source. All time-lapse movies were deconvolved using SoftWoRx. At least 20 individual cells with nearly stationary nuclei were used to track the trajectory of origin focus for each strain using Imaris (Bitplane), and MSD curves, Rc, and volumes were derived as previously described (Caridi et al., 2018) the error bars represent standard error.


Watch the video: DNA gyrase, often referred to simply as All About Molecular Biology (December 2022).