Information

Optogenetics - How do microbial opsins work?

Optogenetics - How do microbial opsins work?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I'm just introduced to the optogenetics method and am having some trouble grasping the genetics (of the optogenteics) part of things.

So we have Retinal and Opsin that form Rhodopsin molecule that serves as a light-gated ion channel (which is, needless to say, very cool).

What is the process in which a cell population is targeted and implanted with these Rhodopsins?

And where does the microbial opsin gets into picture?

My main resource, so far, was - Optogenetics - Method of the year/Nature.

Thanks!


There is nothing special about the use of rhodopsin when compared to making a cell express any transgene. This question can then be read as:

What is the process in which a cell population is targeted and implanted with a gene of interest?

There are many ways, which depend on the specific cell type and on whether you want to do it in vitro, in vivo and in which species, and it would be very complex to explain them all in detail here, so I will limit myself to two approaches that are popular when doing optogenetics in rodents: viral infection and transgenesis.

Viral infection uses an inactivated virus to deliver the transgene. Essentially you engineer a piece of DNA with the gene for the bacterial opsin of interest and you put it in a viral envelope, that is a series of proteins that form the "body" of the virus and that contain its genetic material.
You then inject the virus in the desired zone (e.g. in a specific brain nucleus) and wait for it to infect the cells around the injection site. A week later those cells will express the transgene.

For (at least, I think) historical reasons the first type of viruses used for this approach were lentiviruses. These, however, are a tad more complex to handle (especially as they require specialised rooms where they can be handled safely) so adeno-associated viruses (AAV) are becoming more and more popular.

Note that the virus is inactivated, that is, it cannot replicate, just infect the cells around the infection site, but it will not be able to spread around. This is both for safety reasons and because you want the infection to be confined to the specific region where you injected the virus.

As I was saying before, instead of putting a bacterial opsin you can put whatever gene of interest, the procedure is the same. As for the opsins, the first two that were used were the channelrhodopsin-2 (ChR2), a channel sensitive to blue light and that can be used to depolarize (=excite) the cells and the halorhodopsin (NpHR), a chloride pump sensitive to yellow light that will, conversely, hyperpolarize (=inhibit) the cells.
There are nowadays tens of variants of these and other opsins that can be used to drive cell activity with lights. Many of these are described in this (beware! Quite technical) review:

Optogenetics in neural systems - Yizhar et al., Neuron 2011

Transgenesis works instead by generating an animal that carries the opsin (or any other gene) in its DNA. This can be done in various way, such as by microinjection of embryonic stem cells carrying the transgene.

You can find a fairly detailed explanation of the process here: Transgenic Cells and Gene Knock-outs, well summed up by this figure (taken by the same page):

Transgenic mice generation http://9e.devbio.com/images/ch02/wt020302-2.jpg">P1 phage, called Cre recombinase, only in the cell type of interest (again, using a specific promoter). Cre has the property of cutting DNA next to specific 34 base-pair-long sequences called loxP (with sequenceATAACTTCGTATAGCATACATTATACGAAGTTAT). Essentially, if you haveloxP-[some sequence in the middle]-loxPand Cre recombinase is around, it will cut away the sequence in the middle, leaving only a loxP sequence.
Hundreds of different Cre-expressing mouse lines are commercially available nowadays, to target many different cell types in different organs.

Now, you just need a construct that allows you to express the opsin in a Cre-dependent manner. This is what was done by the group of Hongkui Zeng, and reported in this paper:
A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. - Madisen et al., Nat. Neurosci. 2012

Without going into too much details, the idea is to flank a STOP sequence with two loxP sites. This will block transcription (that is what a STOP sequence does) unless Cre-recombinase is present.

Essentially:


Source: myself, CC-by-sa licensed, feel free to reuse it

Note that in the scheme, ROSA26 is an ubiquitous promoter, that is, a promoter used by all cells, so in this case the specificity is given by expression of Cre recombinase and not by the promoter of this construct. Also, a fluorescent reporter (e.g. GFP) is inserted to be able to visualize where the opsin is expressed.

By breeding these mice with the Cre-line(s) of your choice you can then express the opsins in the cell type of your interest.


Frontiers in Neural Circuits

The editor and reviewers' affiliations are the latest provided on their Loop research profiles and may not reflect their situation at the time of review.



SHARE ON

Talk Overview

Optogenetics is a combination of genetics and optics to achieve a gain or loss of function of biochemical events such as action potentials in a particular neuron or tissue. Opsin genes encode proteins that receive light and give rise to ion flow. This talk gives an introduction to optogenetics followed by examples of how optogenetics is being used to study the brain.

Questions

  1. Which of the following is/are true about opsins (select all that apply)?
    1. Activated by light
    2. Give rise to ion flow
    3. Activated by ions
    4. Can inhibit cells
    1. Describes the wavelength of light needed to activate the opsin
    2. Describes the time constant of deactivation of the opsin after the light is turned off
    3. Describes the time constant of activation of the opsin after light is applied
    4. Describes the number of opsins needed to be expressed on a cell to achieve activation

    Answers

    1. A, B, D
    2. Optogenetics can increase precision and specificity in excitation and inhibition. One can send these signals to a single cell or tissue if desired. The same cell/tissue can be turned on and off and controlled temporally to give control of biochemical events.
    3. B
    4. Since τ off is the time constant of deactivation of the opsin after the light is turned off, a long τ off means the cell will remain activated after the light is removed. This is useful because several pulses of low level light can be used to activate or inhibit the opsin instead of a higher intensity pulse of light. The activation/inhibition can happen without light being continuously delivered and thus is less invasive because the opsin will remain activated even when the light source is taken away since activation is persistent. These channels can be turned off with a different photon of light (e.g. on with blue light, off with green light). Lastly one can capture native activity of the cell after it is activated as opposed to prescribing a spike pattern.

    Membrane Proteins—Production and Functional Characterization

    Martha E. Sommer , . Patrick Scheerer , in Methods in Enzymology , 2015

    3.1.1 Crystallization of ligand-free opsin and opsin–peptide complexes

    Frozen opsin membranes (e.g., 1.5 mg in 200 μl) are thawed, resuspended, and centrifuged to remove the storage buffer (4 °C). The pellet is then resuspended with

    1.3 ml solubilization buffer (20 mM BTP, pH 7.5, 0.7–1.5% n-octyl-β- d -glucopyranoside (OG) and 0.02% n-dodecyl-β- d -maltopyranoside (DDM), or OG alone) and incubated at 4 °C for 2–4 h. The suspension is then centrifuged at 156,400 × g for 10 min at 4 °C in a tabletop ultracentrifuge to separate soluble opsin from insoluble matter. The opsin concentration is determined by absorbance (ɛ280 nm = 0.0812 μM − 1 cm − 1 Surya et al., 1995 ). Crystallization of ligand-free opsin or Ops*–GαCT1 complex is carried out by the sparse-matrix method ( Jancarik & Kim, 1991 ) using screening kits from Hampton Research, Jens Bioscience, or QIAGEN. Promising conditions are systematically screened by altering protein concentration, precipitation agents, temperature, and pH. Optimized ligand-free opsin crystals are grown by the hanging-drop vapor diffusion method at 4 °C using 24-well Linbro plates. Each hanging drop is prepared on a siliconized coverslip by mixing equal volumes (2 μl each) of solubilized opsin (5 mg/ml) and reservoir solution. The reservoir solution contains 2.8–3.4 M ammonium sulfate in 0.1 M MES or 0.1 M sodium acetate buffer, pH 5.0–6.0. Colorless opsin crystals usually appear within 2–3 days and grow further for 5 days. Fully grown crystals usually have maximal dimensions of (0.2 mm × 0.2 mm × 0.3 mm Fig. 1 A ). When 11-cis-retinal is soaked into the crystal, a color change to red (dark gray in the print version) is observed ( Fig. 1 B), which vanishes after illumination with bright light, indicating that rhodopsin can be regenerated from the opsin in these crystals. For crystallization of opsin in complex with peptide, GαCT1 or ArrFL-1 is added to solubilized opsin at a molar ratio of 4:1 or 12:1, respectively, and crystallization is carried out as described above ( Fig. 1 C and F).

    Figure 1 . Crystals of different functional forms of rhodopsin. (A) Colorless crystal of ligand-free Ops* at low pH. (B) Red (dark gray in the print version) crystal of Ops* soaked with 11-cis-retinal. (C) Colorless crystal of ligand-free Ops* in complex with GαCT1 peptide. (D) Yellow (gray in the print version) crystals of Meta II with soaked all-trans-retinal. (E) Yellow (gray in the print version) crystal of Meta II in complex with GαCT2 peptide and with soaked all-trans-retinal. (F) Colorless crystal of ligand-free Ops* in complex with ArrFL-1.


    How Does Optogenetics Work?

    Optogenetics began with the discovery of opsins, such as ChR2. Opsins are light-sensitive channels that cause the depolarization or hyperpolarization of neurons through mechanisms such as the influx of ions or protein signaling cascades ( Kim et al. 2017 ).

    Opsins are sensitive to specific wavelengths of light, leading to the activation or inhibition of neural activity. For example, blue light (

    470 nm) activates ChR2, causing an influx of Na+ ions and, in turn, depolarizing the neuron ( Boyden et al. 2005 ). With viral expression and transgenic animal models, researchers can target optogenetic probes to genetically-defined neuron populations and across brain-wide projections ( Kim et al. 2017 ).

    Multi-disciplinary collaborations between neuroscientists, biologists, and engineers have led to the expansion of the optogenetic toolbox. Opsins have been discovered for manipulating neurons on or off at varying speeds and with different wavelengths of light (see Table 1). For example, Halorhdopsin, an inhibitory opsin, was found to turn off neurons, and red-activated opsins, such as JAWS, were developed to penetrate deeper into the brain ( Kim et al. 2017 ).

    Optogenetic ConstructExcitation WavelengthFunction
    ChR2470nmActivation
    GtACR2470nmInhibition
    ArchT540nmInhibition
    C1v1560nmActivation
    NpHr590nmInhibition
    bReaChES590nmActivation
    Chrimson590nmActivation
    ReaChR620nmActivation
    JAWS620nmInhibition


    Delivering your opsin

    The standard opsin delivery method is local injection of an adeno-associated viral (AAV) construct using stereotaxic surgery (see videos below). The Deisseroth lab has developed many of these AAV constructs with various promoters and other genetic manipulations to help restrict expression to a specific neuronal subtype. However, the length of promoter that can be used in an AAV construct is limited to only a few kb so attaining neuronal specificity through promoter-directed expression alone is extremely limited. Therefore, highly expressing, generic neuronal promoters such as synapsin or camKIIα drive most of the constructs. As an alternative, some constructs have been engineered with a double-floxed inverse open-reading frame (DIO). Upon coexpression with cre recombinase (either from a mouse line or viral co-injection), the opsin is inverted into the correct direction and expressed (under control of a generic promoter). A DIO opsin allows cell type specificity dependent on the promoter of the cre recombinase while still taking advantage of the robust expression via the promoter in the AAV construct.


    Two-Photon-Induced Selective Decarboxylation of Aspartic Acids D85 and D212 in Bacteriorhodopsin

    The interest in microbial opsins stems from their photophysical properties, which are superior to most organic dyes. Microbial rhodopsins like bacteriorhodopsin (BR) from Halobacterium salinarum have an astonishingly high cross-section for two-photon-absorption (TPA), which is of great interest for technological applications such as data storage. Irradiation of BR with intense laser pulses at 532 nm leads to formation of a bathochromic photoproduct, which is further converted to a photochemical species absorbing in the UV range. As demonstrated earlier, the photochemical conversions are induced by resonant TPA. However, the molecular basis of these conversions remained unresolved. In this work we use mass spectroscopy to demonstrate that TPA of BR leads to selective decarboxylation of two aspartic acids in the vicinity of the retinal chromphore. These photochemical conversions are the basis of permanent two-photon data storage in BR and are of critical importance for application of microbial opsins in optogenetics.

    Keywords: bacteriorhodopsin channelrhodopsin data storage optogenetics purple membrane retinal two-photon.


    Access to Document

    • APA
    • Standard
    • Harvard
    • Vancouver
    • Author
    • BIBTEX
    • RIS

    Atomistic design of microbial opsin-based blue-shifted optogenetics tools. / Kato, Hideaki E. Kamiya, Motoshi Sugo, Seiya Ito, Jumpei Taniguchi, Reiya Orito, Ayaka Hirata, Kunio Inutsuka, Ayumu Yamanaka, Akihiro Maturana, Andrés D. Ishitani, Ryuichiro Sudo, Yuki Hayashi, Shigehiko Nureki, Osamu.

    Research output : Contribution to journal › Article › peer-review

    T1 - Atomistic design of microbial opsin-based blue-shifted optogenetics tools

    N1 - Funding Information: We thank A. Kurabayashi and Sawako Tabuchi for technical support, and the beamline staff members at BL32XU of SPring-8 (Hyogo, Japan) for technical help during data collection. We also thank Keiichi Inoue for assistance with the AR3 experiments. This work was financially supported by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology to S.H. (25104004 and 25291034), to Y.S. (23687019) and to O.N. (24227004), the Programme for Promotion of Basic and Applied Researches for Innovations in Bio-oriented Industry and Science and Technology Research Promotion Program for Agriculture, Forestry, Fisheries and Food Industry to S.H. Some computations were performed at the Research Center for Computational Science, Okazaki, Japan. Publisher Copyright: © 2015 Macmillan Publishers Limited. All rights reserved.

    N2 - Microbial opsins with a bound chromophore function as photosensitive ion transporters and have been employed in optogenetics for the optical control of neuronal activity. Molecular engineering has been utilized to create colour variants for the functional augmentation of optogenetics tools, but was limited by the complexity of the protein-chromophore interactions. Here we report the development of blue-shifted colour variants by rational design at atomic resolution, achieved through accurate hybrid molecular simulations, electrophysiology and X-ray crystallography. The molecular simulation models and the crystal structure reveal the precisely designed conformational changes of the chromophore induced by combinatory mutations that shrink its π-conjugated system which, together with electrostatic tuning, produce large blue shifts of the absorption spectra by maximally 100 nm, while maintaining photosensitive ion transport activities. The design principle we elaborate is applicable to other microbial opsins, and clarifies the underlying molecular mechanism of the blue-shifted action spectra of microbial opsins recently isolated from natural sources.

    AB - Microbial opsins with a bound chromophore function as photosensitive ion transporters and have been employed in optogenetics for the optical control of neuronal activity. Molecular engineering has been utilized to create colour variants for the functional augmentation of optogenetics tools, but was limited by the complexity of the protein-chromophore interactions. Here we report the development of blue-shifted colour variants by rational design at atomic resolution, achieved through accurate hybrid molecular simulations, electrophysiology and X-ray crystallography. The molecular simulation models and the crystal structure reveal the precisely designed conformational changes of the chromophore induced by combinatory mutations that shrink its π-conjugated system which, together with electrostatic tuning, produce large blue shifts of the absorption spectra by maximally 100 nm, while maintaining photosensitive ion transport activities. The design principle we elaborate is applicable to other microbial opsins, and clarifies the underlying molecular mechanism of the blue-shifted action spectra of microbial opsins recently isolated from natural sources.


    Light Delivery and Response Recording

    Optimized technologies for light delivery and response recording are vital for optogenetics, given the quick timeframe in which responses in neurons occur. For optogenetic experiments in vivo, light is delivered by either a fiber optic cable or a solid-state light source through an implanted device or an embedded window (Zorzos et al., 2010). Wavelengths that can penetrate deeper into tissues are ideal so that researchers can study even those cell types that are deep within tissues. For example, recent modifications to the NpHR opsin have enabled its ability to respond to red/far-red light (Zhang et al., 2008).

    The responses of the cells simulated with light are recorded with optrodes that enable fast readouts of electrical signals (Nakamura et al., 2013). It is of great importance that these optrodes can record electrical signals as quickly as the light is delivered, down to the millisecond, to ensure that the timescales of the response are captured accurately.

    As more researchers begin tinkering with optogenetics, the toolbox grows and evolves. We look forward to exciting new findings in neuroscience and beyond that will continue to emerge from the darkness.

    Additional Reading:

    Deisseroth, K. Optogenetics: Controlling the Brain with Light. Scientific American. October 20, 2010

    Yizhar, O., Fenno, L., Zhang, F., Hegemann, P., Deisseroth, K. (2011) Microbial Opsins: A Family of Single-Component Tools for Optical Control of Neural Activity. In Helmchen, F., Konnerth, A., Yuste, R., editors. Imaging in Neuroscience: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. 200 pp41_52.

    Karl Deisseroth, K. (2011) Optogenetics. Nature Methods. 8, 26–29. doi:10.1038/nmeth.f.324

    James Butler, J. Optogenetics: shining a light on the brain. Biosceince Horizons. 5, hzr020. doi: 10.1093/biohorizons/hzr020

    References:

    • Abbott SB, Stornetta RL, Fortuna MG, Depuy SD, West GH, et al. (2009). Photostimulation of retrotrape- zoid nucleus phox2b-expressing neurons in vivo produces long-lasting activation of breathing in rats. J. Neurosci. 29, 5806–5819.
    • Alilain WJ, Li X, Horn KP, Dhingra R, Dick TE, et al. (2008). Light-induced rescue of breathing after spinal cord injury. J. Neurosci. 28, 11862–11870.
    • Banghart, M., Borges, K., Isacoff, E., Trauner, D., Kramer, R.H., (2004). Light-activated ion channels for remote control of neuronal firing. Nat. Neurosci. 7, 1381–1386.
    • Bellmann D, Richardt A, Freyberger R, Nuwal N, Schwarzel M, et al. (2010). Optogenetically induced olfactory stimulation in Drosophila larvae reveals the neuronal basis of odor-aversion behavior. Front. Behav. Neurosci. 4, 27.
    • Boyden ES. (2011). A history of optogenetics: the development of tools for controlling brain circuits with light. F1000 Biology Reports. 3, 11.
    • Boyden, E.S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. (2005). Millisecond-timescale, genetically targeted optical control of neural activity. Nat. Neurosci. 8, 1263–1268.
    • Diester, I., Kaufman, M.T., Mogr,i M., Pashaie, R., Goo, W. et al. (2011). An optogenetic toolbox designed for primates. Nat. Neurosci. 14, 387–397
    • Gradinaru, V., Thompson, K.R., Deisseroth, K. (2008). eNpHR: A Natronomonas halorhodopsin enhanced for optogenetic applications. Brain Cell Biology. 36, 129–139.
    • Gunaydin, L.A., Yizhar, O., Berndt, A., Sohal, V.S., Deisseroth, K., Hegemann, P. (2010). Ultrafast optogenetic control. Nat. Neurosci. 13, 387–392.
    • Kanbar, R., Stornetta, R.L., Cash, D.R., Lewis, S.J., Guyenet, P.G. (2010). Photostimulation of Phox2b medullary neurons activates cardiorespiratory function in conscious rats. Am. J. Respir. Crit. Care Med. 182, 1184–1194
    • Han, X, Boyden, E.S. (2007). Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. PloS One 2, e299.
    • Nagel, G., Ollig, D., Fuhrmann, M., Kateriya, S., Musti, A.M., Bamberg, E., Hegemann, P., (2002). Channelrhodopsin-1: a light-gated proton channel in green algae. Science. 296, 2395–2398.
    • Nagel, G., Szellas, T., Huhn, W., Kateriya, S., Adeishvili, N., Berthold, P., Ollig, D., Hegemann, P., Bamberg, E. (2003). Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proc. Natl. Acad. Sci. U.S.A. 100, 13940–13945.
    • Nakamura, S., Baratta, M.V., Cooper, D.C. (2013). A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons. In vivo. J. Vis. Exp. 79, e50291.
    • Oesterhelt, D. & Stoeckenius, W. (1971). Rhodopsin-like Protein from the Purple Membrane of Halobacterium halobium. Nat. New Biol. 233, 149–152.
    • Surya A, Knox B, Enhancement of Opsin Activity by all-trans-retinal. Experimental Eye Research. 66, 599–603, .
    • Zemelman, B.V., Lee, G.A., Ng, M., Miesenböck, G., 2002. Selective Photostimulation of Genetically ChARGed Neurons. Neuron. 33, 15–22.
    • Zhang, F., Gradinaru, V., Adamantidis, A.R., Durand, R., Airan, R.D., et al. 2010. Optogenetic interrogation of neural circuits: technology for probing mammalian brain structures. Nat. Protoc. 5, 439–56.
    • Hongkui Z., Madisen, L. (2012). Mouse Transgenic Approaches in Optogenetics. Progress in brain research 196, 193–213.
    • Zhang, F., Vierock, J., Yizhar, O., Fenno, L.E., Tsunoda, S., Kianianmomeni, A., Prigge, M., Berndt, A., Cushman, J., Polle, J. et al. (2011) The Microbial Opsin Family of Optogenetic Tools. Cell. 147, 1446–1457.
    • Zhang, F., Wang,,L., Brauner, M., Liewald, J., Kay, K., Watzke, N., Wood, P., Bamberg, E., Nagel, G., Gottschalk, A., Deisseroth K (2007). Multimodal fast optical interrogation of neural circuitry. Nature. 446, 633–639.
    • Zhang, F., Prigge, M., Beyrière, F., Tsunoda, S.P., Mattis, J., Yizhar, O., Hegemann, P., Deisseroth, K. (2008) Red-shifted optogenetic excitation: a tool for fast neural control derived from Volvox carteri. Nat Neurosci. 11, 631–633.
    • Zorzos AN, Boyden ES, Fonstad CG. (2010). Multiwaveguide implantable probe for light delivery to sets of distributed brain targets. Opt Lett. 35, 4133–5.

    Stay in the know with our twice monthly news update delivered to your inbox.


    How Scientists Are Using the Technology

    Many labs are now using these optogenetic tools to drive or silence specific neurons within the brain, to figure out how they contribute to behavior, or to determine how they contribute to symptoms of neural disorders or ways of overcoming neural disorders. Working with nonprofit distributors of viruses, DNA, and transgenic mice, our group at MIT has now distributed these reagents to approximately 500 research groups around the world. As one of many examples, groups have used these tools to activate and silence a small cluster of neurons, the hypocretin/orexin neurons in the hypothalamus, deep in the brain of living mice, showing that when driven, they result in awakening of mice, 19 and when silenced, they result in mice falling asleep. 20 This kind of study enables scientists to pinpoint the causal role that specific neurons play in the brain, revealing principles of how the brain works. In addition, the technology identifies cells that could serve as specific drug targets for pharmaceutical development. For example, it is possible that drugs that selectively modulate this population of cells could be of use in the sleep-disorder therapy field. Over the last few years, studies have been published pinpointing neurons or pathways involved with reward, anxiety, spinal-cord injury, and many other behaviors and brain disorders, revealing both principles of basic brain operation as well as new targets for drugs or electrodes to be used in the treatment of brain disorders.

    Some groups have also proposed that such technologies could be used directly as therapeutic technologies. For example, many forms of human blindness involve loss of photoreceptors, light-sensitive cells in the retina (the image-receiving and -processing neural component of the eye). No classical small-molecule drug can replace the lost photoreceptors. However, by taking these light-sensitive proteins and delivering them to the spared, remaining cells of the eye using a gene therapy, 15,21 it is possible to enable other cells to recapitulate the lost image-receiving function normally performed by the photoreceptors. Previously blind mice, when treated with such gene-therapy vectors, can make cognitive use of visual information, even solving mazes with their restored sense of vision. 22 The recent safe demonstration of the use of these molecules in the non-human primate brain may, if borne out by continued safety testing, bode well for therapies based on optogenetic tools. 23 Already groups have begun to explore the use of temporally precise optical control to treat, in animal models, other disease states such as diabetes, Parkinson’s, and chronic pain.

    The ability to precisely enter information into specific cells embedded within the nervous system is opening up the ability to precisely determine which cells make critical contributions to behavioral and disorder-related processes. This knowledge set will reveal new targets for clinical treatment of brain disorders, and the technology itself may eventually find use as a building block of a new set of ultra-precise neural control prosthetics.